Juna Laura UD Batx

of 68 /68
Del DN proteï Unitat didàctica d Universitat Pompeu Fabra Tutora: Mar Carrió Llach Mentor: Xavier Muñoz Màster en Formació del Aprenentatge i Ensenyam 2014-2015 JUNA FUMÀS BOIXADE LAURA MATAS LALUEZ NA a les ïnes de 1r de batxillerat Professorat de Ciències Naturals ment de les Ciències Naturals III ERA ZA

Embed Size (px)

description

UD Biologia 1r Batxillerat: Del DNA a les proteïnes

Transcript of Juna Laura UD Batx

  • Del DNA a les proteUnitat didctica de 1r de batxillerat

    Universitat Pompeu Fabra

    Tutora: Mar Carri Llach Mentor: Xavier Muoz

    Mster en Formaci del Aprenentatge i Ensenyament de les Cincies Naturals III

    2014-2015

    JUNA FUMS BOIXADERALAURA MATAS LALUEZA

    Del DNA a les nes

    Unitat didctica de 1r de batxillerat

    Mster en Formaci del Professorat de Cincies Naturals Aprenentatge i Ensenyament de les Cincies Naturals III

    JUNA FUMS BOIXADERA LAURA MATAS LALUEZA

  • ndex

    1. INTRODUCCI ____________________________________________________________________ 4

    2. UNITAT DIDCTICA DE BATXILLERAT: REPLICACI, TRANSCRIPCI I TRADUCCI DEL MISSATGE

    GENTIC _____________________________________________________________________________ 6

    CONTEXT DAPRENENTATGE I DAPLICACI _____________________________________________________ 6

    TREBALL PER COMPETNCIES ______________________________________________________________ 6

    Competncies generals _____________________________________________________________ 6

    Competncies especfiques __________________________________________________________ 6

    OBJECTIUS DAPRENENTATGE ______________________________________________________________ 7

    Objectius generals _________________________________________________________________ 7

    Objectius especfics ________________________________________________________________ 7

    Objectius procedimentals ___________________________________________________________ 8

    Objectius actitudinals ______________________________________________________________ 8

    CONTINGUTS _________________________________________________________________________ 9

    SEQNCIA DACTIVITATS _________________________________________________________________ 9

    Sessi 1 _________________________________________________________________________ 9

    Sessi 2 _________________________________________________________________________ 9

    Sessi 3 ________________________________________________________________________ 10

    Sessi 4 ________________________________________________________________________ 11

    Sessi 5 ________________________________________________________________________ 12

    Sessi 6 ________________________________________________________________________ 13

    Sessi 7 ________________________________________________________________________ 14

    CRITERIS GENERALS DATENCI A LA DIVERSITAT _________________________________________________ 14

    CRITERIS GENERALS DAVALUACI __________________________________________________________ 14

    CONNEXI AMB ALTRES MATRIES __________________________________________________________ 15

    3. MATERIAL PER ALS ALUMNES ______________________________________________________ 17

    La fenilcetonria ____________________________________________________________________ 18 Com es replica el DNA? _______________________________________________________________ 20 La replicaci del DNA _________________________________________________________________ 25 Expressi gnica: del DNA al mRNA ______________________________________________________ 31

    EL MISSATGE AMAGAT DARRERA LA FENILALANINA HIDROXILASA ______________________________________ 33 Qu passa dins dels ribosomes? ________________________________________________________ 35

    Diferncies entre eucariotes i procariotes _____________________________________________ 37 Demostra qu has aprs! ______________________________________________________________ 39

    MATERIAL PER ALS PROFESSORS ________________________________________________________ 41

    REPLICACI DEL DNA __________________________________________________________________ 42

    SINTETITZEM LA FENILALANINA HIDROXILASA! __________________________________________________ 43

    CURSA DE RELLEUS DEL CODI GENTIC _______________________________________________________ 68

  • Del DNA a les protenes 4 Introducci

    1. Introducci La nostra unitat didctica semmarca en lassignatura de biologia de 1r de batxillerat i treballa

    la replicaci, la transcripci i la traducci del DNA. Es contextualitza mitjanant el cas de la Mar,

    una noia de ledat dels nostres alumnes que t fenilcetonria (PKU), una malaltia monognica.

    Ella mateixa explica qu s la PKU, quins smptomes t i quina ns la causa. El text serveix per

    introduir el dogma central de la gentica, per extreure les idees prvies i com a fil conductor.

    Cada classe sinicia amb un petit text en el qual la Mar planteja diferents preguntes (que, de fet,

    sn similars a les preguntes didees prvies) per mirar dentendre millor com i per qu es

    donen els diferents processos.

    Durant la unitat didctica es contemplen diferents tipus dobjectius. Els de contingut pretenen

    que els alumnes coneguin els diferents processos pels quals un gen dna lloc a una protena, i

    que siguin capaos dexplicar-los, aix com la importncia i el funcionament daquests. Per altra

    banda, amb els objectius procedimentals i actitudinals volem aconseguir que siguin capaos de

    treballar cooperativament, gestionar-se el temps, ajudar-se els uns als altres, ser respectuosos

    i saber fer i rebre crtiques constructives. Tamb ens agradaria que fossin conscients de qu

    representa haver de conviure amb una malaltia. A ms, volem que sadonin de qu estan

    aprenent i per tant que sautoregulin el seu propi aprenentatge. Per ltim, tenim uns objectius

    generals de lrea de biologia: volem que comprenguin missatges de contingut cientfic, que es

    plantegin diferents hiptesis i que extreguin conclusions a partir devidncies i proves

    experimentals.

    Les dificultats amb les quals ens podem trobar estan molt relacionades amb la metodologia, ja

    que noms una de les set sessions consistir en una classe magistral. La resta de sessions es

    basen en el treball en equip: comprensi dun text i extracci didees, interpretaci

    dexperiments i validaci dhiptesis, construcci del coneixement mitjanant un joc de rol,

    cursa de relleus, exercicis en parella, coavaluaci dexercicis, etc. Totes aquestes activitats

    poden ser molt motivadores, per ens podem trobar amb la dificultat del canvi ja que sn

    alumnes que no estan acostumats a participar i que fan classes en les quals agafen apunts i

    estan callats. Tot i aix, creiem que sadaptaran b a les noves dinmiques perqu sn un grup

    treballador i homogeni, i que el canvi ser positiu. A aquest possible problema shi suma el de

    les dificultats conceptuals ja que els mecanismes i la funci biolgica dels diferents processos

    sn conceptes fora abstractes. Per evitar que es perdin cada dia els donarem els apunts del

    que hem treballat, de manera que a casa sho podran repassar, i cada dia comenarem les

    classes resolent possibles dubtes i fent una sntesi al final de la classe. Tamb ens preocupa la

    temporitzaci, per esperem no tenir problemes ja que les classes sn duna hora per les

    hem preparat de 50 minuts i hem intentat no comprimir-les massa. Tot i aix, tal com hem

    acordat amb el mentor, no hi haur cap problema si necessitem ms sessions.

    Lavaluaci dels coneixements ser contnua. La seva funci ser formadora i formativa, aix

    com dautoregulaci de laprenentatge. El 60% de la nota estar basat en el dossier, el 10% en

    la capacitat de treballar cooperativament i lactitud i el 30% en lexamen.

  • 5 Introducci

    El producte final que volem obtenir s un dossier en el qual tenen tota la informaci que ells

    han recollit sumada a la que nosaltres els hem donat. Aquest ens permetr avaluar-los i fer-los

    un seguiment i a ms els ser molt til a lhora de tenir tota la informaci de la unitat recollida

    i ordenada.

  • Del DNA a les protenes 6 Unitat didctica de batxillerat: replicaci, transcripci i traducci del missatge gentic

    2. Unitat didctica de batxillerat: replicaci, transcripci i traducci del missatge gentic

    Context daprenentatge i daplicaci Es presenta el cas duna noia amb fenilcetonria. Ella mateixa explica qu s la PKU, quins

    smptomes t i qu la causa. Aquest cas serveix per introduir el dogma central de la gentica:

    es tracta de la mutaci en un gen que dna lloc a una protena errnia del metabolisme de la

    fenilalanina. Daquesta manera podem introduir el procs pel qual el DNA es duplica (la

    replicaci) i pel qual dna lloc a les protenes (la transcripci i la traducci).

    Treball per competncies

    Competncies generals

    Competncia comunicativa, lingstica i audiovisual: Interpretar vdeos i textos sobre la

    replicaci, transcripci i traducci, i expressar les prpies idees de manera clara i

    endreada tant oralment com de manera escrita.

    Competncia tractament de la informaci i competncia digital: Sintetitzar i aplicar la

    informaci transmesa en forma de textos, vdeos o explicacions per realitzar les

    activitats practiques proposades com ara el joc de la traducci, la cursa de relleus, els

    exercissis, etc.

    Competncia dautonomia i iniciativa personal: Treballar en equip, adquirint

    coneixements de forma autnoma (quan llegeixen el text de la replicaci sols, quan

    shan dajudar per entendre la traducci, etc.).

    Competncia social i ciutadania: Ser capa de comprendre el component social de

    conviure amb una malaltia.

    Competncia personal i interpersonal: Gestionar i organitzar el temps personal i del

    grup, autoregulaci del propi aprenentatge mitjanant la coavaluaci dactivitats

    (correcci de la forquilla de replicaci i de les activitats finals de sntesi), sentir

    satisfacci per aplicar els models cientfics per explicar el mn, utilitzar els processos de

    replicaci, transcripci i traducci per explicar una malaltia, respectar les opinions dels

    companys i ser conscient de la importncia que t aprendre dells i ajudar-los.

    Competncia en recerca: Elaborar hiptesis, analitzar evidncies i justificar-les

    (experiment de Meselson i Stahl).

    Competncies especfiques

    Competncia en la comprensi de la naturalesa de la cincia: s darguments lgics per

    contrastar les hiptesis de la replicaci del DNA i valorar les teories i models proposats.

    Comunicar mitjanat el llenguatge cientfic les principals caracterstiques dels processos

    de replicaci, transcripci i traducci.

    Comprendre textos cientfics sobre els processos de replicaci, transcripci i traducci i

    disposar de criteris per analitzar-los crticament.

  • 7 Unitat didctica de batxillerat: replicaci, transcripci i traducci del missatge gentic

    Objectius daprenentatge

    Objectius generals

    Relacionar contextos de la vida quotidiana, com pot ser tenir una malaltia gentica, amb

    conceptes especfics de la biologia.

    Comprendre missatges de contingut cientfic, com pot ser lexplicaci de la replicaci,

    amb tots els enzims implicats en ella.

    Obtenir conclusions a partir devidncies i proves experimentals, com en el cas de les

    diferents hiptesis de la replicaci del DNA.

    Comunicar missatges de contingut cientfic utilitzant el llenguatge oral i escrit, com ara

    quan han descriure al dossier all que han ents de la transcripci.

    Valorar crticament la informaci que reben.

    Objectius especfics SESSI 1

    Explicitar els coneixements previs sobre la gentica, concretament sobre els processos

    de replicaci, transcripci i traducci del DNA.

    Extreure i gestionar la informaci del text contextualitzat sobre la PKU.

    SESSI 2

    Situar on es produeixen els processos de replicaci, transcripci i traducci dins duna

    cllula eucariota i procariota.

    Analitzar les hiptesis sobre la replicaci del DNA i la seva viabilitat.

    Predir els resultats de les situacions experimentals que es van plantejar Meselson i Stahl

    per demostrar de quina manera es replica el DNA.

    Interpretar un text sobre les possibles hiptesis de la replicaci del DNA i lexperiment

    de Meselson i Stahl.

    SESSI 3

    Explicar als companys qu han ents del text explicatiu de la replicaci del DNA.

    Analitzar els dubtes que sorgeixin desprs de llegir el text de la replicaci del DNA.

    Reconstruir el procs de replicaci del DNA.

    Relacionar el text de la replicaci del DNA amb lesquema daquest procs.

    Reconixer les diferncies de la replicaci entre eucariotes i procariotes.

    Aplicar individualment els conceptes treballats a classe per reconstruir laltra meitat de

    la forquilla de replicaci.

  • Del DNA a les protenes 8 Unitat didctica de batxillerat: replicaci, transcripci i traducci del missatge gentic

    SESSI 4

    Identificar els errors dels companys en la reconstrucci de la forquilla de replicaci i ser

    capaos de corregir-los.

    Comprendre el procs de transcripci.

    Analitzar el vdeo de la transcripci.

    Reconixer les diferncies entre la transcripci en eucariotes i procariotes.

    Identificar l existncia i importncia dels gens reguladors.

    SESSI 5

    Explicitar els dubtes del procs de replicaci.

    Construir el procs de traducci mitjanant un joc de rol.

    SESSI 6

    Explicitar els dubtes del procs de traducci.

    Comprendre pas per pas el procs de la traducci.

    Comprendre qu s el codi gentic.

    Aplicar els coneixements de replicaci, transcripci i traducci per a completar una taula

    mitjanant una cursa de relleus.

    SESSI 7

    Aplicar els continguts treballats fent exercicis per repassar els processos de replicaci,

    transcripci i traducci.

    Objectius procedimentals

    Saber com funciona el procs de la replicaci del DNA.

    Saber transcriure i traduir un fragment de DNA.

    Utilitzar el treball cooperatiu per a la comprensi i interpretaci de lectures.

    Gestionar el temps.

    Apropiar-se dels objectius daprenentatge i dels criteris davaluaci.

    Autoregular laprenentatge.

    Objectius actitudinals

    Mostrar actituds de respecte envers els companys.

    Acceptar les crtiques dels companys.

    Valorar les dificultats que representa patir una malaltia.

  • 9 Unitat didctica de batxillerat: replicaci, transcripci i traducci del missatge gentic

    Continguts Els alumnes hauran de conixer que el DNA s el portador del material gentic, la composici

    qumica que presenten els cids nucleics, els nivells estructurals i dempaquetament de lcid

    desoxiribonucleic, aix com els tipus dcid ribonucleic (tRNA, mRNA i rRNA).

    Explicaci i localitzaci dels processos de duplicaci del DNA, transcripci i traducci.

    s d'animacions i simulacions per ordinador i resoluci de problemes en l'estudi

    d'aquests processos.

    Evidenciaci de la universalitat i significat del codi gentic.

    Seqncia dactivitats

    Sessi 1 FASE DEL CICLE

    Exploraci didees prvies.

    DESCRIPCI

    A linici de la sessi els explicarem breument als alumnes com treballarem durant els dies que

    els fem classes. Els explicarem que farem una avaluaci continuada de totes les sessions i que

    tot el material que donem i que demanem que facin el recollirem lltim dia perqu tamb

    ser avaluable (5).

    Comenarem la sessi llegint un text on sexplica lexperincia duna noia que presenta la

    malaltia de la fenilcetonria (10).

    Demanarem als alumnes que responguin les preguntes del text que els ajudaran a introduir el

    tema que tractarem els propers dies a classe (processos de replicaci, transcripci i traducci

    del DNA) i a extreure les idees prvies que tenen sobre el tema. Primer ho faran

    individualment (10), compararan les respostes en parelles (10), i finalment ho posarem en

    com entre tots (15).

    GESTI DAULA

    A linici de la sessi demanarem un voluntari per llegir en veu alta el text proposat.

    Individualment hauran de respondre les preguntes plantejades, desprs comentaran les seves

    respostes amb un company i finalment farem una posada en com.

    MATERIALS I RECURSOS

    Text de la PKU

    Preguntes

    Sessi 2 FASE DEL CICLE

    Introducci als processos de replicaci, transcripci i traducci.

  • Del DNA a les protenes 10 Unitat didctica de batxillerat: replicaci, transcripci i traducci del missatge gentic

    DESCRIPCI

    A linici de la classe mostrarem un esquema de la cllula amb els processos de replicaci,

    transcripci i traducci situats all on es produeixen, tant de cllules eucariotes com

    procariotes. Daquesta manera els introduirem tot all que treballarem els dies segents (10).

    A continuaci els donarem lexplicaci de les 3 hiptesis que expliquen la replicaci del DNA i,

    per grups, hauran de predir els resultats que sobtindrien per cadascuna delles. Per fer-ho els

    donarem algunes preguntes que els guiaran a lhora de fer tot aquest plantejament. Finalment

    els donarem els resultats de lexperiment de Meselson i Stahl, de manera que hauran de

    decidir quina de les tres hiptesis s la vlida (35).

    Abans dacabar la classe els donarem un text amb lexplicaci del procs de replicaci del

    DNA, que lhauran de llegir de deures. Aquest text ens servir per introduir-los aquest procs,

    que treballarem ms concretament el segent dia de classe (5).

    GESTI DAULA

    Comenarem la sessi fent un esquema per situar els diferents processos dins la cllula.

    En grups de 3 hauran de discutir i posar-se dacord sobre quina s la hiptesi de replicaci

    vlida. Desprs de fer la predicci i de respondre les preguntes farem una posada en com

    entre tots.

    Al final de la sessi farem els grups amb els quals treballaran durant la sessi 4, i els donarem

    un text sobre la replicaci perqu sel llegeixin a casa.

    MATERIALS I RECURSOS

    Explicaci de les 3 hiptesis de la replicaci del DNA.

    Experiment de Meselson i Stahl.

    Preguntes per guiar-los.

    Text de la replicaci.

    Sessi 3 FASE DEL CICLE

    Introducci a la replicaci del DNA.

    Aplicaci de la replicaci del DNA.

    DESCRIPCI

    En petits grups els alumnes sexplicaran el text de la replicaci que hauran llegit de deures. La

    idea s que entenguin tot el que puguin amb lajuda dels companys, tot responent una srie de

    preguntes que els serviran de guia (15).

    Desprs, construirem un dibuix de replicaci a la pissarra entre tots. Els alumnes hauran de

    prendre apunts del procs que expliquem. Noms explicarem la meitat de la forquilla de

    replicaci perqu aix podran construir laltra meitat individualment de deures i els quedar

    ms clar el procs (30).

  • 11 Unitat didctica de batxillerat: replicaci, transcripci i traducci del missatge gentic

    Tamb els mostrarem un vdeo de la replicaci que els ajudar a resoldre dubtes que els hagin

    sorgit a classe o perqu els ajudi mentre facin els deures.

    Per ltim, farem una breu explicaci de les diferncies entre la replicaci deucariotes i de

    procariotes (5).

    GESTI DAULA

    A linici de la classe, els alumnes es posaran en grups de 3, que prviament ja haurem establert

    per explicar-se el que han ents del text.

    Desprs, farem una reproducci del procs de replicaci a la pissarra, construint-lo amb la

    participaci de tots els alumnes.

    MATERIALS I RECURSOS

    Vdeo de la replicaci que els proposarem:

    https://www.youtube.com/watch?v=YqjbmrQcyfM

    Sessi 4 FASE DEL CICLE

    Sntesi de la replicaci.

    Introducci de la transcripci.

    DESCRIPCI

    Comenarem la classe corregint la forquilla de replicaci que havien de completar de deures.

    La correcci la faran intercanviant el full amb un company, de manera que seran ells mateixos

    els que hauran de detectar els errors dels companys i corregir-los. Desprs recollirem les

    forquilles de replicaci i les tornarem corregides el prxim dia (10).

    Un cop ja tinguin clara la replicaci comenarem a treballar la transcripci i la maduraci de

    lmRNA. Per fer-ho els farem una explicaci del procs i els mostrarem un vdeo de la

    transcripci perqu els quedi ms clar. Explicarem les diferncies en el procs de transcripci

    en eucariotes i procariotes(35).

    Per ltim, tamb els farem una pinzellada de la importncia que tenen els gens reguladors en

    aquest procs (5). Els alumnes tindran un espai al seu dossier per prendre notes de totes

    aquestes explicacions.

    Demanarem als alumnes que es mirin un vdeo de la traducci que ser molt important per

    lactivitat del segent dia.

    GESTI DAULA

    Durant la correcci dels deures, els alumnes treballaran en parelles.

    Per fer lexplicaci de la transcripci, els passarem una presentaci amb imatges molt clares

    del procs. En tot moment demanarem la participaci dels alumnes perqu no es perdin.

    MATERIALS I RECURSOS

    Presentaci de la transcripci i maduraci de lmRNA.

  • Del DNA a les protenes 12 Unitat didctica de batxillerat: replicaci, transcripci i traducci del missatge gentic

    Vdeo de la transcripci.

    Enlla del vdeo de la traducci: https://www.youtube.com/watch?v=5bLEDd-PSTQ

    Dibuix de la forquilla de replicaci corregida.

    Sessi 5 FASE DEL CICLE

    Aplicaci de la transcripci i traducci.

    DESCRIPCI

    Com que el dia anterior haurem demanat als alumnes que es mirin un vdeo de la traducci, ja

    tindran una idea de com funciona el procs. Tot i aix, si ho veiem necessari el tornarem a

    mirar (5).

    Abans de comenar el joc resoldrem els dubtes que els hagin sorgit i farem una breu explicaci

    de lactivitat (10).

    Per fer lactivitat de traducci farem 5 grups de 6 alumnes. Repartiren un full on hi haur

    especificades les funcions de diversos elements que es troben implicats en el procs de la

    transcripci i de la traducci. Deixarem 10 perqu els alumnes el llegeixin i es reparteixin els

    rols. Cadasc haur de realitzar la funci dun dels enzims.

    Lactivitat consistir en una competici entre els 5 grups, en la qual hauran de representar el

    procs de traducci (25):

    A la zona del nucli hi haur diferents seqncies de DNA:

    o Les RNA polimerases hauran dentrar al nucli per transcriure les seqncies de

    DNA a RNA.

    o Un cop obtinguda la seqncia dmRNA, la RNA polimerasa correctora reparar els

    errors, i pel procs dsplicing seliminaran els introns.

    o Safegir el CAP a lextrem 5 i la poliA polimerasa afegir la cua de poliA.

    Un cop madur lmRNA sortir al citosol:

    o La ribonucleasa s lencarregada de tallar la cua de poliA. Quan aquest enzim

    elimini totes les Adenines, lmRNA deixar de ser actiu.

    o Els tRNA ja estaran associats amb els aminocids respectius i estaran repartits per

    tot lespai del citosol.

    o Els aminoacil- tRNA arribaran al ribosoma, on es traduir la seqncia.

    o Cada aminocid tindr una lletra associada. Quan els alumnes aconsegueixin

    traduir tota la seqncia, podran formar una frase ajuntant totes les lletres que

    trobaran a cada aminocid. Noms si ho han fet b la frase tindr sentit.

    GESTI DAULA

    Aquesta sessi es far en un espai gran.

  • 13 Unitat didctica de batxillerat: replicaci, transcripci i traducci del missatge gentic

    Farem 5 grups de 6 alumnes, en el qual cadasc tindr atribut un rol dun element de la

    transcripci/traducci.

    Cada grup tindr una base a la qual shauran de quedar fins que no es requereixi la seva funci.

    Aix, els alumnes entraran al terreny de joc noms quan hagin de portar a terme el seu rol.

    Quan els tRNA arribin al ribosoma, tots els membres del grup hauran de traduir la seqncia.

    El grup que acabi abans tot el procs, sempre i quan estigui realitzat de forma correcte, tindr

    un obsequi.

    MATERIALS I RECURSOS

    Full amb lexplicaci de tots els rols del joc.

    Ribosoma.

    Seqncia que volem traduir.

    Cues de poliA.

    CAPs.

    Targetes dels aminoacil-tRNA.

    Cinta adhesiva.

    Zona del nucli delimitada.

    Obsequi (un caramel o alguna cosa per lestil).

    Sessi 6 FASE DEL CICLE

    Sntesi de la traducci.

    Aplicaci de la transcripci i traducci.

    DESCRIPCI

    Comenarem la classe fent un reps rpid de la traducci i explicant all que pot no haver-los

    quedat clar del tot. Tamb parlarem del codi gentic i la seva universalitat (25).

    Acabada lexplicaci, separarem els alumnes en grups de 4 i farem una cursa de relleus que

    consistir en convertir una seqncia, que ser igual per tots els grups, de DNA mRNA

    tRNA aminocid. Les seqncies les presentarem en forma de quadre de manera que no

    sempre donarem la seqncia de DNA, sin que tamb podrem indicar quin s laminocid,

    lmRNA o el tRNA, i a partir daquest completar tota la resta. Quan acabin de completar la

    taula la corregirem entre tots i posarem en com els dubtes. Si surt loportunitat comentarem

    com creuen que una mutaci pot influenciar en el codi gentic (25).

    GESTI DAULA

    Per fer lactivitat farem grups de 4 alumnes. Cada grup tindr penjada a la paret de la classe

    una cartolina amb la taula que shaur de completar, la qual estar dividida en 12 trossos.

    Cada grup tindr 4 participants, de manera que quan donem lavs, sortiran els primers de cada

  • Del DNA a les protenes 14 Unitat didctica de batxillerat: replicaci, transcripci i traducci del missatge gentic

    grup, i quan aquests hagin acabat podran sortir els segents, i aix successivament. Com que

    tindrem la seqncia dividida en 12 trossos, cada alumne sortir a completar la taula 3

    vegades.

    MATERIALS I RECURSOS

    4 cartolines amb la taula de les seqncies sense completar i dividida en 12 trossos.

    Sessi 7 FASE DEL CICLE

    Aplicaci i sntesi dels processos de replicaci, transcripci i traducci.

    DESCRIPCI

    Donarem als alumnes un full amb diferents activitats sobre tot el que hem treballat a classe.

    Daquesta manera, els alumnes podran aplicar tot all que han aprs i nosaltres podrem

    comprovar si ho han ents tot (25). Desprs els alumnes corregiran els exercicis duna altra

    parella (25).

    Per ltim, explicarem als alumnes que el dia de lexamen hauran dentregar el dossier de tota

    la unitat didctica. Daquesta manera podrem saber com han treballat i els podrem avaluar el

    dossier.

    GESTI DAULA Els alumnes sajuntaran per parelles per resoldre els exercicis. Quan hagin acabat

    sintercanviaran el full amb una altra parella i el corregiran. Avaluarem les parelles segons com

    hagin fet els exercicis i com hagin corregit als companys.

    MATERIALS I RECURSOS

    Full dactivitats

    Criteris generals datenci a la diversitat Treballarem de forma cooperativa, en grups, perqu els alumnes es vegin obligats a ajudar-se

    els uns als altres. En el moment dexplicar qu sha ents li pot tocar fer-ho a qualsevol

    membre del grup, de manera que els mateixos components del grup shan dassegurar que

    tots els companys ho hagin ents. A ms, durant les activitats prctiques tots els alumnes

    tindran un rol i, per tant, tots hauran dentendre els processos per poder-hi participar.

    Per altra banda, les explicacions teriques les farem fent participar tots els alumnes, de

    manera que acabarem construint entre tots el coneixement i sempre deixarem un temps de la

    classe per resoldre dubtes que hagin pogut sorgir.

    Com que hi haur moltes estones en les que els alumnes treballaran en petits grupets, anirem

    passant pels grups fent un seguiment de com van tots els alumnes, especialment els que tenen

    ms dificultats. Tamb farem un seguiment de totes les activitats que es fan a laula i de la

    participaci que tenen tots ells, per tal de detectar aquells que vagin ms perduts.

    Criteris generals davaluaci Dossier: 60%

    o Tasca hiptesis de replicaci: 20%

  • 15 Unitat didctica de batxillerat: replicaci, transcripci i traducci del missatge gentic

    - Resposta a les preguntes: 10%

    - Justificaci de la hiptesi correcta: 10%

    o Tasques de la replicaci: 10%

    - Comprensi del text en grup: 5% (0,5 punts per cada pregunta ben resposta)

    - Forquilla de replicaci: 5%

    o Tasca final: 20%

    - Realitzaci: 10%

    - Coavaluaci: 10%

    o Presentaci del dossier: 10%

    Lavaluarem fent servir una rbrica:

    Alumne:

    Molt

    (4 punts)

    Bastant

    (3 punts)

    B

    (2 punts)

    Poc

    (1 punt)

    Gens

    (0 punts)

    Dossier complet

    Apunts de classe

    Claredat i netedat

    Exercicis corregits

    Treball cooperatiu i actitud: 10%

    Lavaluarem fent servir una rbrica:

    Alumne:

    Molt

    (4 punts)

    Bastant

    (3 punts)

    B

    (2 punts)

    Poc

    (1 punt)

    Gens

    (0 punts)

    Pregunta dubtes

    Mostra actitud

    participativa

    Es mostra atent/a a

    les explicacions

    Ajuda als companys

    Fa els deures

    Examen de la unitat: 30%

    Connexi amb altres matries Cincies per almn contemporani

    Sinopsi de les bases moleculars i funcionals de la gentica: cids nucleics, estructura dels

    gens, codificaci i expressi de la informaci gentica. Identificaci del genoma com a

    tret distintiu dels organismes: relaci entre els gens i l'evoluci.

  • Del DNA a les protenes 16 Unitat didctica de batxillerat: replicaci, transcripci i traducci del missatge gentic

    Llenges

    Obtenci d'informaci rellevant de diferents fonts i en diferents suports, elaborar-la,

    contrastant-la i usant-la en el plantejament d'un problema o debat.

    Treballar el llenguatge pel que fa a justificar, analitzar continguts, descriure, argumentar

    i escriure correctament.

    Valoraci i argumentaci crtica sobre el binomi salut- malaltia.

  • 17 Material per als alumnes

    3. Material per als alumnes

    En aquest apartat incloem el dossier que dia a dia anirem repartint als alumnes. Els espais en

    blanc sn lespai que tenen per treballar; en algunes classes es tracta que hi apuntin les seves

    respostes, en altres el consens entre les seves respostes i les dels companys, i en altres els

    apunts que han pres durant la classe.

  • La fenilcetonria

    Em dic Mar i tinc 17 anys. Sc una noia ben normal,

    faig 1r de batxillerat i jugo a bsquet. Quan acabi el

    batxillerat magradaria estudiar biomedicina per

    dedicar-me a la investigaci de malalties,

    concretament a la fenilcetonria

    alguna cosa tant especfica? us preguntareu. Doncs

    perqu tant bon punt vaig nixer em van fer la proba del tal per la detecci preco de

    malalties i van saber que tinc PKU, una malaltia que si no es diagnostica a temps s

    molt greu ja que dna lloc a problemes en el creixement i en el sistema nervis central.

    Ni els meus pares ni cap dels meus dos germans tenen PKU. El metge em va explicar

    que el gen que la causa es troba al gen PAH, situat al cromosoma 12. La protena per la

    qual codifica el gen PAH s lenzim fenilalanina hidroxilasa, que catalitza el pas de

    laminocid essencial fenilalanina a tirosina. Com que jo tinc el gen PAH mutat en tots

    dos cromosomes 12 no tinc una fenilalanina hidroxilasa funcional, per tant la reacci

    no es duu a terme correctament,

    no hi ha el producte, la tirosina, que s

    un aa que, entre altres coses, s

    precursor de neurotransmissors. Per aix sen diu fenilcetonria, que vol dir tenir

    elevades concentracions de fenilalanina en sang i orina.

    Tot i aix, com us he dit tinc una vida ben normal, i no tinc cap mena de retard mental

    ni res de res. Aix s perqu sempre he tingut i tinc una dieta molt controlada, en la

    qual no ingereixo fenilalanina aix e

    molt resumit no puc menjar carn, peix, ous, llet, he de controlar molt les quantitats de

    cereals, llegums i fruits secs, i he de prendre un suplement proteic que cont tots els

    aa (excepte la fenilalanina, clar), i que especialment cont tirosina. Amb aix queden

    cobertes totes les meves necessitats proteiques, fins i tot les de la fenilalanina, que en

    molt poques quantitats es troba en alguns dels aliments que menjo.

    Respon les segents preguntes indiv

    1. On es troba la informaci gentica? Qu determina que un nounat tingui

    fenilcetonria?

    Del DNA a les protenesMaterial per als alumnes

    Em dic Mar i tinc 17 anys. Sc una noia ben normal,

    faig 1r de batxillerat i jugo a bsquet. Quan acabi el

    batxillerat magradaria estudiar biomedicina per

    me a la investigaci de malalties,

    concretament a la fenilcetonria (PKU). I per qu

    alguna cosa tant especfica? us preguntareu. Doncs

    perqu tant bon punt vaig nixer em van fer la proba del tal per la detecci preco de

    malalties i van saber que tinc PKU, una malaltia que si no es diagnostica a temps s

    e dna lloc a problemes en el creixement i en el sistema nervis central.

    Ni els meus pares ni cap dels meus dos germans tenen PKU. El metge em va explicar

    que el gen que la causa es troba al gen PAH, situat al cromosoma 12. La protena per la

    ca el gen PAH s lenzim fenilalanina hidroxilasa, que catalitza el pas de

    laminocid essencial fenilalanina a tirosina. Com que jo tinc el gen PAH mutat en tots

    dos cromosomes 12 no tinc una fenilalanina hidroxilasa funcional, per tant la reacci

    uu a terme correctament, sacumula el substrat, en aquest cas la fenilalanina, i

    no hi ha el producte, la tirosina, que s

    un aa que, entre altres coses, s

    precursor de neurotransmissors. Per aix sen diu fenilcetonria, que vol dir tenir

    ntracions de fenilalanina en sang i orina.

    Tot i aix, com us he dit tinc una vida ben normal, i no tinc cap mena de retard mental

    ni res de res. Aix s perqu sempre he tingut i tinc una dieta molt controlada, en la

    fenilalanina aix evito que sacumuli i shan acabat els problemes! Aix

    molt resumit no puc menjar carn, peix, ous, llet, he de controlar molt les quantitats de

    cereals, llegums i fruits secs, i he de prendre un suplement proteic que cont tots els

    na, clar), i que especialment cont tirosina. Amb aix queden

    cobertes totes les meves necessitats proteiques, fins i tot les de la fenilalanina, que en

    molt poques quantitats es troba en alguns dels aliments que menjo.

    Respon les segents preguntes individualment (10 min):

    On es troba la informaci gentica? Qu determina que un nounat tingui

    Del DNA a les protenes 18 Material per als alumnes

    perqu tant bon punt vaig nixer em van fer la proba del tal per la detecci preco de

    malalties i van saber que tinc PKU, una malaltia que si no es diagnostica a temps s

    e dna lloc a problemes en el creixement i en el sistema nervis central.

    Ni els meus pares ni cap dels meus dos germans tenen PKU. El metge em va explicar

    que el gen que la causa es troba al gen PAH, situat al cromosoma 12. La protena per la

    ca el gen PAH s lenzim fenilalanina hidroxilasa, que catalitza el pas de

    laminocid essencial fenilalanina a tirosina. Com que jo tinc el gen PAH mutat en tots

    dos cromosomes 12 no tinc una fenilalanina hidroxilasa funcional, per tant la reacci

    sacumula el substrat, en aquest cas la fenilalanina, i

    precursor de neurotransmissors. Per aix sen diu fenilcetonria, que vol dir tenir

    Tot i aix, com us he dit tinc una vida ben normal, i no tinc cap mena de retard mental

    ni res de res. Aix s perqu sempre he tingut i tinc una dieta molt controlada, en la

    vito que sacumuli i shan acabat els problemes! Aix

    molt resumit no puc menjar carn, peix, ous, llet, he de controlar molt les quantitats de

    cereals, llegums i fruits secs, i he de prendre un suplement proteic que cont tots els

    na, clar), i que especialment cont tirosina. Amb aix queden

    cobertes totes les meves necessitats proteiques, fins i tot les de la fenilalanina, que en

    On es troba la informaci gentica? Qu determina que un nounat tingui

    | 1

  • 19 Material per als alumnes

    2. Qu s el que falla en les persones amb PKU? Com expliques la relaci entre

    lerrada en la informaci gentica i el mal funcionament daquest enzim? Quina

    conseqncia t el mal funcionament de la fenilalanina hidroxilasa en

    el metabolisme de la fenilalanina en tirosina?

    3. Quin tipus dherncia t la PKU? Justifica-ho.

    4. Sabem que les persones afectades per la fenilcetonria no tenen la protena

    fenilalanina hidroxilasa funcional i que aix s degut a una mutaci en el DNA dels

    seus dos pares. Com texpliques que a partir duna nica cllula formada per un

    espermatozoide portador de la mutaci i un vul tamb portador de la mutaci, es

    desenvolupi un nen/a en el qual totes les seves cllules porten la mutaci?

    5. Perqu s tant important fer una detecci preco de la malaltia?

    6. Quin s el tractament que segueixen les persones afectades per aquesta malaltia?

    | 2

  • Com es replica el DNA?

    Sanomena replicaci del DNA el procs de duplicaci o sntesi daquest cid nucleic

    que t lloc en cada generaci cellular. Quan es va descobrir la transcendncia del DNA

    i de la seva duplicaci es va especular molt sobre com era aquesta. Per aix es van

    formular diferents hiptesis:

    a) Hiptesi conservativa: es conserva la doble hlix original i sen forma una altra de

    completament nova.

    b) Hiptesi dispersiva: no es conserven les cadenes originals.

    antiga com la nova queden barrejades.

    c) Hiptesi semiconservativa

    cadena vella i una de nova.

    Del DNA a les protenesMaterial per als alumnes

    replica el DNA?

    Tinc un embolic molt important! No entenc res! S

    que tinc fenilcetonria perqu la meva protena

    fenilalanina hidroxilasa no s funcional degut a una

    mutaci en el DNA dels dos gens PAH meus. Aix vol

    dir que els meus dos pares mhan transms aquesta

    informaci errnia, el pare en lespermatozoide i la

    mare en lvul. Em podries ajudar a entendre com pot

    ser que a partir duna nica cllula (zigot) totes les

    cllules del meu cos tinguin la mateixa mutaci als

    gens PAH?

    replicaci del DNA el procs de duplicaci o sntesi daquest cid nucleic

    que t lloc en cada generaci cellular. Quan es va descobrir la transcendncia del DNA

    i de la seva duplicaci es va especular molt sobre com era aquesta. Per aix es van

    diferents hiptesis:

    : es conserva la doble hlix original i sen forma una altra de

    : no es conserven les cadenes originals. Tant la doble hlix

    antiga com la nova queden barrejades.

    semiconservativa: les dues doble hlix resultants estan formades per una

    cadena vella i una de nova.

    Del DNA a les protenes 20 Material per als alumnes

    Tinc un embolic molt important! No entenc res! S

    que tinc fenilcetonria perqu la meva protena

    fenilalanina hidroxilasa no s funcional degut a una

    mutaci en el DNA dels dos gens PAH meus. Aix vol

    transms aquesta

    informaci errnia, el pare en lespermatozoide i la

    mare en lvul. Em podries ajudar a entendre com pot

    ser que a partir duna nica cllula (zigot) totes les

    cllules del meu cos tinguin la mateixa mutaci als

    replicaci del DNA el procs de duplicaci o sntesi daquest cid nucleic

    que t lloc en cada generaci cellular. Quan es va descobrir la transcendncia del DNA

    i de la seva duplicaci es va especular molt sobre com era aquesta. Per aix es van

    : es conserva la doble hlix original i sen forma una altra de

    ant la doble hlix

    : les dues doble hlix resultants estan formades per una

    | 3

  • 21 Material per als alumnes

    Experiment de Meselson i Stahl La demostraci duna daquestes hiptesis fou aportada per Meselson i Stahl lany

    1957. Aquests cientfics van cultivar els bacteris Escherichia coli en un medi amb

    nitrogen pesant (N15). El N15 t el mateix nombre delectrons (7e) i de protons (7p),

    per t un neutr ms (8n), de manera que s ms pesat que el N14 (el que es troba en

    condicions normals). Aix comporta que les molcules de DNA sintetitzades a partir de

    N15 pesin ms que les sintetitzades amb N14. Grcies a aquesta diferncia de densitats

    s possible separar per centrifugaci les molcules de DNA que han incorporat el N14

    de les que han incorporat el N15.

    Per fer lexperiment, Meselson i Stahl van passar els bacteris cultivats amb N15 a un

    medi amb nitrogen normal N14. Els van deixar crixer durant una mitja hora (temps

    necessari perqu el DNA bacteri es dupliqui 1 vegada), van extreure el DNA i el van

    centrifugar per a que se separes en gradients de densitat. Desprs dobservar els

    resultats obtinguts en la generaci 1, van deixar crixer els mateixos bacteris una

    segona vegada (tamb en un medi amb N14) per tal dobtenir la generaci 2, van

    extreure el DNA i el van centrifugar.

    Ara que saps quin s lexperiment que es va realitzar, respon les segents preguntes:

    1. On sincorpora el N durant la sntesi de DNA?

    2. Qu esperaries veure en cadascun dels casos? Omple la segent taula segons

    lexemple. Tingues en compte que a la primera generaci hi haur dues molcules

    de DNA i que a la segona generaci nhi haur quatre. Utilitza un color per les

    cadenes o trossos de cadena pesades, i un altre per les lleugeres, ja siguin de

    primera o de segona generaci.

    | 4

  • Generaci

    Hip

    te

    si c

    on

    serv

    ati

    va

    DNA

    original

    1a

    generaci

    2a

    generaci

    Generaci

    Hip

    te

    si d

    isp

    ers

    iva

    DNA

    original

    1a

    generaci

    Del DNA a les protenesMaterial per als alumnes

    Tipus de N que sincorpora

    a cada cadena Resultats de la centrifugaci

    N15/N15

    Tipus de N que sincorpora

    a cada cadena Resultats de la centrifugaci

    N15/N15

    Del DNA a les protenes 22 Material per als alumnes

    Resultats de la centrifugaci

    Resultats de la centrifugaci

    | 5

  • 23 Material per als alumnes

    2a

    generaci

    Generaci

    Hip

    te

    si s

    em

    ico

    nse

    rvat

    iva

    DNA

    original

    1a

    generaci

    2a

    generaci

    Tipus de N que sincorpora

    a cada cadena Resultats de la centrifugaci

    N15/N15

    Resultats de la centrifugaci

    | 6

  • Els resultats de lexperiment van ser els que veus a la imatge. Quina creus que s la hiptesi

    que explica aquests resultats? Justifica la teva resposta.

    Del DNA a les protenesMaterial per als alumnes

    Els resultats de lexperiment van ser els que veus a la imatge. Quina creus que s la hiptesi

    que explica aquests resultats? Justifica la teva resposta.

    Del DNA a les protenes 24 Material per als alumnes

    Els resultats de lexperiment van ser els que veus a la imatge. Quina creus que s la hiptesi

    | 7

  • 25 Material per als alumnes

    La replicaci del DNA

    Sanomena replicaci del DNA el procs de duplicaci o sntesi daquest cid nucleic

    que t lloc en cada generaci cellular, s a dir, cada cop que una cllula es divideix.

    Aquesta sntesi compleix unes regles

    la sntesi de lmRNA a partir del DNA durant la transcripci:

    1. Les noves cadenes de nucletids se sintetitzen copiant brins de DNA preexistents,

    anomenats DNA motlle. Durant la replicaci es copien les dues

    la doble hlix de DNA, per tant en resulten dues doble hlixs que tenen exactament

    la mateixa informaci que loriginal (la mateixa seqncia de les bases dels

    nucletids).

    2. Els enzims que copien els cids nucleics a partir dun motlle pr

    polimerases. Aix, les DNA

    polimerases sintetitzen RNA, tots dos enzims a del DNA motlle.

    3. La sntesi de noves cadenes es fa sempre i nicament en el sentit 5

    polimerases llegeixen el DNA motlle en sentit 3

    Polaritat de les cadenes del DNA en la forqueta de replicaci

    Mecanismes de la replicaciLa sntesi del DNA s un pr

    denominades orgens de replicaci

    La replicaci del DNA

    Clar! Totes i cadascuna de les meves cllules tenen la

    mutaci perqu totes venen de la mateixa cllula

    original, el zigot, que es va dividint fins a donar lloc a

    totes les cllules. Cada cop que una cllula es

    divideix necessita duplicar el seu material gentic.

    Sanomena replicaci del DNA el procs de duplicaci o sntesi daquest cid nucleic

    que t lloc en cada generaci cellular, s a dir, cada cop que una cllula es divideix.

    Aquesta sntesi compleix unes regles que, en la seva major part, sn vlides tamb per

    mRNA a partir del DNA durant la transcripci:

    Les noves cadenes de nucletids se sintetitzen copiant brins de DNA preexistents,

    anomenats DNA motlle. Durant la replicaci es copien les dues cadenes motlle de

    la doble hlix de DNA, per tant en resulten dues doble hlixs que tenen exactament

    la mateixa informaci que loriginal (la mateixa seqncia de les bases dels

    Els enzims que copien els cids nucleics a partir dun motlle preexistent sn les

    polimerases. Aix, les DNA-polimerases sn enzims que sintetitzen DNA i les RNA

    polimerases sintetitzen RNA, tots dos enzims a del DNA motlle.

    La sntesi de noves cadenes es fa sempre i nicament en el sentit 5

    es llegeixen el DNA motlle en sentit 3 5.

    Polaritat de les cadenes del DNA en la forqueta de replicaci.

    Mecanismes de la replicaci La sntesi del DNA s un procs complex que sinicia en unes regions

    de replicaci.

    Clar! Totes i cadascuna de les meves cllules tenen la

    mutaci perqu totes venen de la mateixa cllula

    original, el zigot, que es va dividint fins a donar lloc a

    totes les cllules. Cada cop que una cllula es

    ecessita duplicar el seu material gentic.

    Sanomena replicaci del DNA el procs de duplicaci o sntesi daquest cid nucleic

    que t lloc en cada generaci cellular, s a dir, cada cop que una cllula es divideix.

    que, en la seva major part, sn vlides tamb per

    Les noves cadenes de nucletids se sintetitzen copiant brins de DNA preexistents,

    cadenes motlle de

    la doble hlix de DNA, per tant en resulten dues doble hlixs que tenen exactament

    la mateixa informaci que loriginal (la mateixa seqncia de les bases dels

    eexistent sn les

    polimerases sn enzims que sintetitzen DNA i les RNA-

    La sntesi de noves cadenes es fa sempre i nicament en el sentit 5 3, ja que les

    del cromosoma

    | 8

  • Una seqncia de nucletids al DNA actua com a senyal diniciaci de tot el procs.

    Primer de tot lenzim helicasa suneix a la doble hlix en lorigen de replicaci; la seva

    funci s obrir la doble hlix trencant els ponts dhidrogen que uneixen les base

    complementries, s a dir, separar les dues cadenes de DNA. Un cop les cadenes estan

    separades les protenes estabilitzadores suneixen al DNA de cadena simple per

    estabilitzar-lo. Ara les dues cadenes de DNA estan separades i estabilitzades, donant

    lloc a la bombolla de replicaci.

    suneix a la doble hlix al dos cantons de lorigen de replicaci per evitar que aquell

    DNA se superenrotlli.

    El procs de sntesi del DNA s

    formen dues forquetes de replicaci

    la bombolla de replicaci, cadascuna de les meitats que queden s una forqueta de

    replicaci. Les dues forquetes es desplacen en sentits oposats ja que

    avanant a mesura que es va obrint la doble hlix.

    Formaci de la bombolla de replicaci en el DNA

    Un cop les cadenes de DNA estan separades, comena la sntesi de noves cadenes de

    DNA a partir de desoxiribonucletids trifosfats (dNTPs). Les DNA polimerases per, no

    poden iniciar un bri de DNA del no res (noms pot allargar una

    per aix comena una RNA polimerasa o primasa, que

    nucletids complementaris al DNA anomenat encebador o

    la DNA polimerasa III pot comenar a unir dNTPs, elongant aix la nova cadena de DNA.

    Tot i que la DNA polimerasa III s molt fidel es poden produir aparellaments de bases

    incorrectes. Per evitar mutacions, el mateix enzim s capa de, abans de posar cada

    nou nucletid, verificar si el darrer est aparellat correctament. Si no s correcte

    lelimina i ho intenta de

    nou. Aquest mecanisme

    eleva la seva fidelitat fins a

    menys dun error per cada

    107 bases copiades.

    Enzims que participen en la replicaci del DNA

    Del DNA a les protenesMaterial per als alumnes

    Una seqncia de nucletids al DNA actua com a senyal diniciaci de tot el procs.

    Primer de tot lenzim helicasa suneix a la doble hlix en lorigen de replicaci; la seva

    funci s obrir la doble hlix trencant els ponts dhidrogen que uneixen les base

    , s a dir, separar les dues cadenes de DNA. Un cop les cadenes estan

    separades les protenes estabilitzadores suneixen al DNA de cadena simple per

    lo. Ara les dues cadenes de DNA estan separades i estabilitzades, donant

    a la bombolla de replicaci. Lenzim girasa, tamb anomenat topoisomerasa,

    suneix a la doble hlix al dos cantons de lorigen de replicaci per evitar que aquell

    El procs de sntesi del DNA s bidireccional: a partir de lorigen de replicaci es

    forquetes de replicaci. Imaginat que tracem una lnia vertical al mig de

    la bombolla de replicaci, cadascuna de les meitats que queden s una forqueta de

    replicaci. Les dues forquetes es desplacen en sentits oposats ja que

    avanant a mesura que es va obrint la doble hlix.

    Formaci de la bombolla de replicaci en el DNA.

    Un cop les cadenes de DNA estan separades, comena la sntesi de noves cadenes de

    a partir de desoxiribonucletids trifosfats (dNTPs). Les DNA polimerases per, no

    poden iniciar un bri de DNA del no res (noms pot allargar una cadena preexistent

    per aix comena una RNA polimerasa o primasa, que sintetitza un bri d

    tids complementaris al DNA anomenat encebador o primer. A partir del primer

    la DNA polimerasa III pot comenar a unir dNTPs, elongant aix la nova cadena de DNA.

    Tot i que la DNA polimerasa III s molt fidel es poden produir aparellaments de bases

    ctes. Per evitar mutacions, el mateix enzim s capa de, abans de posar cada

    nou nucletid, verificar si el darrer est aparellat correctament. Si no s correcte

    lelimina i ho intenta de

    nou. Aquest mecanisme

    eleva la seva fidelitat fins a

    r per cada

    Enzims que participen en la

    Del DNA a les protenes 26 Material per als alumnes

    Una seqncia de nucletids al DNA actua com a senyal diniciaci de tot el procs.

    Primer de tot lenzim helicasa suneix a la doble hlix en lorigen de replicaci; la seva

    funci s obrir la doble hlix trencant els ponts dhidrogen que uneixen les bases

    , s a dir, separar les dues cadenes de DNA. Un cop les cadenes estan

    separades les protenes estabilitzadores suneixen al DNA de cadena simple per

    lo. Ara les dues cadenes de DNA estan separades i estabilitzades, donant

    Lenzim girasa, tamb anomenat topoisomerasa,

    suneix a la doble hlix al dos cantons de lorigen de replicaci per evitar que aquell

    de replicaci es

    . Imaginat que tracem una lnia vertical al mig de

    la bombolla de replicaci, cadascuna de les meitats que queden s una forqueta de

    replicaci. Les dues forquetes es desplacen en sentits oposats ja que cadascuna va

    Un cop les cadenes de DNA estan separades, comena la sntesi de noves cadenes de

    a partir de desoxiribonucletids trifosfats (dNTPs). Les DNA polimerases per, no

    cadena preexistent),

    un bri d RNA duns 10

    . A partir del primer

    la DNA polimerasa III pot comenar a unir dNTPs, elongant aix la nova cadena de DNA.

    Tot i que la DNA polimerasa III s molt fidel es poden produir aparellaments de bases

    ctes. Per evitar mutacions, el mateix enzim s capa de, abans de posar cada

    nou nucletid, verificar si el darrer est aparellat correctament. Si no s correcte

    | 9

  • 27 Material per als alumnes

    Les dues cadenes motlle tenen direccions diferents i per aix la sntesi de les noves

    cadenes varia. La cadena conductora se sintetitza de manera contnua, mentre que la

    cadena retardada se sintetitza de manera discontnua.

    En la cadena conductora la direcci de la sntesi del nou bri de DNA s 5 3, per tant

    la primasa comena a unir NTPs a lextrem 3 del DNA motlle. Com que lhelicasa va

    obrint la forquilla de replicaci a mesura que avana la sntesi de la nova cadena,

    aquesta se sintetitza de manera contnua fins al final. La cadena conductora final est

    formada pel primer de RNA a linici i la cadena de DNA. Abans que conclogui la

    replicaci la DNA polimerasa I eliminar el primer de RNA i omplir el buit que queda

    amb dNTPs, de manera que finalment tota la nova cadena de DNA noms estar

    formada per DNA.

    En la cadena retardada el procs s ms complicat. Igual que en la cadena conductora,

    la direcci de la sntesi del nou bri de DNA s 5 3, per tant la primasa comena a

    unir NTPs a lextrem 3 del DNA motlle. El problema per, s que en aquesta cadena la

    sntesi de nou DNA i laven de la forquilla de replicaci van en direccions oposades.

    Per aix, fins que no sha obert un tros de la forquilla de replicaci no queda lliure un

    extrem 3 del DNA motlle i la primasa pot unir els NTPs (en direcci 5 3) i a

    continuaci la DNA pol III unir dNTPs fins que arriba al punt dinici. Daquesta manera

    es crea un bri format per uns 50 nucletids de RNA i uns 2000 de DNA, anomenat

    fragment dOkazaki. Aix doncs, quan la forquilla ja sha tornat a obrir una mica ms, a

    lesquerra del fragment sen comena a formar un altre, i aix successivament.

    Finalment la DNA polimerasa I substitueix el primer de RNA per DNA i omple els buits

    que han quedat entre els diferents fragments dOkazaki. Per acabar la DNA ligasa

    uneix tots els fragments de DNA de la cadena.

    En les cllules procariotes noms es crea un origen de replicaci ja

    que el seu DNA s fora curt, en canvi, en les cllules eucariotes hi

    ha centenars dorgens de replicaci en cada cromosoma ja que el

    seu DNA s ms llarg. Per aix com que est superenrotllat i associat

    Replicaci del DNA en procariotes

    Sntesi de la cadena conductora i

    la retardada.

    | 10

  • Del DNA a les protenes 28 Material per als alumnes

    a histones, la replicaci del DNA en eucariotes s molt ms lenta que en procariotes.

    * Mira aquest vdeo, tajudar a entendre-ho millor:

    https://www.youtube.com/watch?v=YqjbmrQcyfM

  • 29 Material per als alumnes

    Desprs de llegir i entendre el text responeu les segents preguntes en grups de 3:

    1. Cada quan es produeix la replicaci del DNA?

    2. Quins enzims sintetitzen el DNA?

    3. Quin enzim sintetitza el RNA?

    4. Com es diu el punt on sinicia la replicaci?

    5. En quin sentit es formen les noves cadenes?

    6. En quin sentit llegeixen el DNA motlle les polimerases?

    7. Quines funcions t la DNA polimerasa III?

    8. Quines diferncies hi ha entre la cadena conductora i la retardada?

    | 11

  • Del DNA a les protenes 30 Material per als alumnes

    9. Qu sn els fragments dOkazaki?

    10. Quina funci t la DNA ligasa?

    | 12

  • 31 Material per als alumnes

    Expressi gnica: del DNA al mRNA

    El mecanisme de la transcripciConsta de tres fases:

    Iniciaci

    Elongaci

    Finalitzaci

    Expressi gnica: del DNA al mRNA

    Ara que ja he ents com pot ser que totes les cllules

    del meu cos tinguin el mateix material gentic em

    sorgeixen altres preguntes. Com pot ser que es passi

    de DNA a protena? Com ho fan les cllules? Son dues

    coses molt diferents per que estan totalme

    relacionades, perqu si el DNA est malament, la

    protena tamb ho est. Com pot ser?!

    El mecanisme de la transcripci

    Ara que ja he ents com pot ser que totes les cllules

    del meu cos tinguin el mateix material gentic em

    sorgeixen altres preguntes. Com pot ser que es passi

    de DNA a protena? Com ho fan les cllules? Son dues

    coses molt diferents per que estan totalment

    relacionades, perqu si el DNA est malament, la

    protena tamb ho est. Com pot ser?!

    | 13

  • Del DNA a les protenes 32 Material per als alumnes

    Maduraci

    Diferncies entre cllules procariotes i eucariotes

    Regulaci de gens

    | 14

  • 33 Material per als alumnes

    Expressi gnica: de l

    *Mira aquest vdeo per tenir una idea de la traducci:

    https://www.youtube.com/watch?v=5bLEDd

    Sintetitzem la fenilalanina hidroxilasaEl joc es duu a terme en grups de 6, en el qual cadasc t un rol:

    1. RNA polimerasa-DNA dirigida:

    de la seqncia de bases del DNA a mRNA (necessita tires de paper blanc i un

    bolgraf o llapis).

    2. RNA polimerasa correctora:

    errors comesos per la RNA polimerasa i els modifica (necessita un bolgraf dun

    color diferent).

    3. Splicing: Es produeix al nucli de la cllula. Procs pel qual seliminaran els introns.

    Ha de tallar els introns i unir els exons (n

    4. Poliadenilat Polimerasa (Poli

    polimerasa afegeix una cua dadenines (la cua de poli

    abans que surti del nucli

    Un altre enzim s lencarregat dafegir el

    ribosomes reconeguin

    nucli cap al ribosoma.

    5. Ribonucleasa: Treballa al citosol.

    poli-A (comena per lltima adenina de la cua). Si sacaba la cua de poli

    deixa de ser actiu i la sntesi de protenes no pot continuar.

    lmRNA a les protenes

    El missatge amagat darrera la fenilalanina hidroxilasa Mira el segent link abans de comenar a jugar o anirs

    molt perdut!

    *Mira aquest vdeo per tenir una idea de la traducci:

    https://www.youtube.com/watch?v=5bLEDd-PSTQ

    Sintetitzem la fenilalanina hidroxilasa! El joc es duu a terme en grups de 6, en el qual cadasc t un rol:

    DNA dirigida: Treballa al nucli de la cllula. Transcriu la informaci

    de bases del DNA a mRNA (necessita tires de paper blanc i un

    RNA polimerasa correctora: Treballa al nucli de la cllula. Revisa els possibles

    errors comesos per la RNA polimerasa i els modifica (necessita un bolgraf dun

    Es produeix al nucli de la cllula. Procs pel qual seliminaran els introns.

    els introns i unir els exons (necessita tisores i celo).

    Poliadenilat Polimerasa (Poli-A): Treballa al nucli de la cllula. La poliadenilat

    a afegeix una cua dadenines (la cua de poli-A) a lextrem 3 de l

    abans que surti del nucli (necessita celo per enganxar la cua de poli-

    Un altre enzim s lencarregat dafegir el CAP a lextrem 5 (s necessari perqu els

    ribosomes reconeguin lmRNA i per protegir-lo de les RNAses). Porta lmRNA del

    Treballa al citosol. Comena a tallar lmRNA a partir de la cadena de

    A (comena per lltima adenina de la cua). Si sacaba la cua de poli

    de ser actiu i la sntesi de protenes no pot continuar.

    Vale! Osigui que del DNA es passa a

    pateix un procs de maduraci en el qual seliminen

    les seqncies que no sn necessries

    protena Tot aix t lgica, al cap i a la fi no hi ha

    tanta diferncia entre el DNA i lRNA, no? La gran

    pregunta aqu s com, a partir duna seqncia de

    ribonucletids, es pot acabar obtenint una protena,

    feta daminocids?

    amagat darrera la fenilalanina

    Mira el segent link abans de comenar a jugar o anirs

    Treballa al nucli de la cllula. Transcriu la informaci

    de bases del DNA a mRNA (necessita tires de paper blanc i un

    Treballa al nucli de la cllula. Revisa els possibles

    errors comesos per la RNA polimerasa i els modifica (necessita un bolgraf dun

    Es produeix al nucli de la cllula. Procs pel qual seliminaran els introns.

    Treballa al nucli de la cllula. La poliadenilat

    A) a lextrem 3 de lmRNA

    -A).

    a lextrem 5 (s necessari perqu els

    lo de les RNAses). Porta lmRNA del

    a tallar lmRNA a partir de la cadena de

    A (comena per lltima adenina de la cua). Si sacaba la cua de poli-A, lmRNA

    lmRNA i aquest

    pateix un procs de maduraci en el qual seliminen

    les seqncies que no sn necessries per la

    protena Tot aix t lgica, al cap i a la fi no hi ha

    RNA, no? La gran

    a partir duna seqncia de

    es pot acabar obtenint una protena,

    | 15

  • Del DNA a les protenes 34 Material per als alumnes

    Atenci ribonucleases! cada 30 segons heu de tallar una adenina (una A de la cua

    poli-A, comenant per lextrem) dels mRNA del vostre grup. Si sacaba la cua no

    podeu continuar amb la sntesi (necessiteu un cronmetre i unes tisores).

    6. Anticod (tRNA):Un cop lmRNA arriba al ribosoma, ha de sintetitzar el

    complementari de lmRNA (lanticod o tRNA) per tal de poder trobar laminocid

    que correspon al mRNA transcrit. Els tRNA ja estan associats amb els aminocids

    respectius i estaran repartits per tot lespai del citosol (necessita un bolgraf).

    Entre tots...

    Lanticod anir demanant quins sn els codons complementaris (aminoacil-tRNA) que

    necessita i els haureu danar a buscar pel citosol. A mesura que porteu els anticodons

    al ribosoma, haureu de separar laa que est unit al tRNA per anar formant el

    polipptid de la fenilalanina hidroxilasa.

    Atenci ribosomes! un cop feta la traducci, noms heu de llegir la lletra remarcada en

    majscula de cada aminocid. Si uniu totes les lletres de cada aminocid obtindreu una

    frase!

    | 16

  • 35 Material per als alumnes

    Qu passa dins dels ribosomes?

    Qu passa dins dels ribosomes?

    Ja quasi ho entenc tot! All que fa uns dies em sonava

    xino ara t sentit. Per exactament, qu passa dins

    dels ribosomes?

    enc tot! All que fa uns dies em sonava

    xino ara t sentit. Per exactament, qu passa dins

    | 17

  • Del DNA a les protenesMaterial per als alumnes

    Del DNA a les protenes 36 Material per als alumnes

    | 18

  • 37 Material per als alumnes

    Diferncies entre eucariotes i procariotes

    | 19

  • Del DNA a les protenes 38 Material per als alumnes

    La clau de la traducci: el codi gentic Qu s el codi gentic?

    Caracterstiques principals:

    | 20

  • 39 Material per als alumnes

    Demostra qu has aprs! 1. La figura segent representa un procs cellular fonamental. Indiqueu el nom del

    procs representat i escriviu en els requadres A, B, C i D el nom dels components

    assenyalats. Quina s la funci de la molcula B de la figura?

    2. a) Prescindint dels triplets d'iniciaci i d'atur (stop), quin s el nombre mnim de

    parell de nucletids presents en el gen de l'enzim ribonucleasa pancretica que

    cont 124 aminocids. Per qu?

    b) Com podeu observar, es tracta dun gen dun individu eucariota. Podria ser molt

    ms gran el nombre real de parells de nucletids existent en aquest gen? Per qu?

    Nom del procs

    Funci de la molcula B

    A

    B

    C

    D

    | 21

  • Del DNA a les protenes 40 Material per als alumnes

    3. a) En els procariotes, el procs mitjanant el qual la informaci gentica es copia de

    lADN a lARNm sanomena ______________. El procs mitjanant el qual la

    informaci de lARNm determina la seqncia daminocids duna cadena

    polipeptdica sanomena ______________. En el codi gentic cada aminocid

    sespecifica mitjanant un ______________de lARNm, anomenat ______________.

    b) Ja sabeu que el codi gentic s de triplets. Quants aminocids es podrien trobar

    a les protenes naturals si cada triplet codifiqus un aminocid diferent?

    c) Hi ha triplets que no codifiquen cap aminocid. Coneixeu la seva funci?

    4. a)A la taula segent responeu "s" o "no" als llocs corresponents:

    Procariotes Eucariotes

    El RNa transcrit ja s el RNA madur

    La transcripci i la traducci tenen lloc en

    compartiments diferents

    La transcipci i la traducci sn simultnies

    b) Justifiqueu breument les respostes afirmatives

    | 22

  • 41 Material per als professors

    Material per als professors

    En aquest apartat incloem els materials necessaris per dur a terme alguna de les classes.

    Obviem el material de les classes magistrals i les posades en com, ja que, desprs de valorar

    els pros i contres, hem decidit no utilitzar les TIC sin explicar-ho mitjanant la pissarra ja que

    sn processos fora enrevessats en els quals un dibuix simple que va evolucionant a mesura

    que avana lexplicaci pot ser la millor soluci (al dossier ja disposen de dibuixos ms

    extensos). Per tant, pel que fa a aquestes classes no tenim cap material especial preparat.

  • Del DNA a les protenes 42 Material per als professors

    Replicaci del DNA En la posada en com de com funciona la replicaci farem un dibuix esquemtic del procs en

    una de les forquilles de replicaci, que ser similar al segent:

  • 43 Material per als professors

    Sintetitzem la fenilalanina hidroxilasa! El material necessari per al joc s:

    1. Taula per saber el rol de cada alumne:

    FUNCI Nom de lalumne

    RNA polimerasa-DNA dirigida

    RNA polimerasa correctora

    Splicing

    Poliadenilat Polimerasa (Poli-A)

    Ribonucleasa

    Anticod (tRNA)

    2. Seqncies de DNA, que donen lloc a una frase amb sentit al ser tradudes correctament.

    Per al professor (respostes):

    1) Un de cada deu mil nens presenta fenilcetonuria

    CTT GCA CTCTGG ACA CGC CTT CGC CTT TGT GTTTAC

    GAA CGU GAG ACC UGU GCG GAA GCG GAA ACA CAA AUG

    CUU GCA CUC UGG ACA CGC CUU CGC CUU UGU GUU UAC

    TAT GAG GCT TGG GCA AGC GGA CTA TGC AGA TGC GCA

    AUA CUC CGA ACC CGU UCG CCU GAU ACG UCU ACG CGU

    UAU GAG GCU UGG GCA AGC GGA CUA UGC AGA UGC GCA

    ACC CGT AAA TGG GCA TAG GAT ACA TGC ACC ATAGCG

    UGG GCA UUU ACC CGU AUC CUA UGU ACG UGG UAU CGC

    ACC CGU AAA UGG GCA UAG GAU ACA UGC ACC AUA GCG

    GTT CTG TAG CGC ATT

    CAA GAC AUC GCG UAA

    GUU CUC UAG CGC AUU

    2) Va ser descrita pel metge norueg Flling

    CAG CGA AGG TGA CTA CTT TGA AGC ACA CTG TAA ACC

    GUC GCU UCC ACU GAU GAA ACU UCG UGU GAC AUU UGG

    CAG CGA AGG UGA CUA CUU UGA AGC ACA CUG UAA ACC

    DNA

    mRNA

    tRNA

  • Del DNA a les protenes 44 Material per als professors

    CGA GGA TGG GAC TAC TGG ACC CCT TGC GCT ATA CTG

    GCU CCU ACC CUG AUG ACC UGG GGA ACG CGA UAU GAC

    CGA GGA UGG GAC UAC UGG ACC CCU UGC GCU AUA CUG

    GTT TGG CCC AAA ATA GAG GAC TAA GCT CCC ATC

    CAA ACC GGG UUU UAU CUC CUG AUU CGA GGG UAG

    GUU UGG CCC AAA AUA GAG GAC UAA GCU CCC AUC

    3) Es va descriure el mil nou-cents trenta quatre

    TGC AGG CAG CGT CTT TGC AGT ACG CTG TAA GTTCTA

    ACG UCC GUC GCA GAA ACG UCA UGC GAC AUU CAA GAU

    UGC AGG CAG CGU CUU UGC AGU ACG CUG UAA GUU CUA

    TGC TGG GAT TAC TAA GAC GCT ATA GTC ACA TGC GCA

    ACG ACC CUA AUG AUU CUG CGA UAU CAG UGU ACG CGU

    UGC UGG GAU UAC UAA GAC GCU AUA GUC ACA UGC GCA

    ACC AGC ACC CTA TGG GCG ACC CGC TTT GTTCGG ACC

    UGG UCG UGG GAU ACC CGC UGG GCG AAA CAA GCC UGG

    ACC AGC ACC CUA UGG GCG ACC CGC UUU GUU CGG ACC

    CTA TGG ACT

    GAU ACC UGA

    CUA UGG ACU

    4) Provoca una olor peculiar a la orina i a la suor

    GGG CTA ATA CAG ATG ACG CGC GTC GCA CGT ATA GAG

    CCC GAU UAU GUC UAC UGC GCG CAG CGU GCA UAU CUC

    GGG CUA AUA CAG AUG ACG CGC GUC GCA CGU AUA GAG

    ATG CTG GGG TGT ACA GTT GAC TAT CGG CTA CGT GAC

    UAC GAC CCC ACA UGU CAACUG AUA GCC GAU GCA CUG

    AUG CUG GGG UGU ACA GUU GAC UAU CGG CUA CGU GAC

    CGC ATACTG TAG GCCCGC TAA CGA GATCGA AGTGTT

    GCG UAU GAC AUC CGG GCG AUU GCU CUA GCU UCA CAA

    CGC AUA CUG UAG GCC CGC UAA CGA GAU CGA AGU GUU

    ATA CTG ATT

    UAU GAC UAA

    AUA CUG AUU

  • 45 Material per als professors

    5) Es va anomenar imbecillitas phenilpiruvica

    TGA AGC CAG CGG CGT GCT ATA TAC TGC GCG CGC CTA

    ACU UCG GUC GCC GCA CGA UAU AUG ACG CGC GCG GAU

    UGA AGC CAG CGG CGU GCU AUA UAC UGC GCG CGC CUA

    TAA TAC TTATGT ACG TAA GAC GAG TAG ACC CGC AGG

    AUU AUG AAU ACA UGC AUU CUG CUC AUC UGG GCG UCC

    UAA UAC UUA UGU ACG UAA GAC GAG UAG ACC CGC AGG

    GGC GTG TGT GCT TAG GAT GGG TAA CTG GTC CAG TAG

    CCG CAC ACACGA AUC CUA CCC AUU GAC CAG GUC AUC

    GGC GUG UGU GCU UAG GAU GGG UAA CUG GUC CAG UAG

    ACA CGA ATC

    UGU GCU UAG

    ACA CGA AUC

    Seqncies que tindran els alumnes (shan dimprimir linealment i posar-les de manera que les

    dues cadenes quedin complementries). Amb taronja es marquen els introns.

    GRUP 1

    3CTTGCACTCACGATCGATCGATTGGACACGCCTTCGCCTTTGTGTTTACTATGAGCCGATCGCCTAGC

    ATGCGGCTTGGGCAAGCGGACTATGCAGATGCGCAACCCGTAAATGGGCATAGGATACATGCACCATA

    GCGGTTCTGTGCATTAAGCTAGTCGTTTAGCGCATT5

    GRUP 2

    3CAGCGATGCATTAAGCTAGTCGTTAGGTGACTACTTTGAAGCACACTGTAAACCCGAGGCGGCTAGC

    GGATCGTACGATGGGACTACTGGACCCCTTGCGCTATACTGGTTTGGCCCAAAATAGAGGACTAAGCT

    ACGATCGATCGATCCCATC5

    GRUP 3

    3TGCAGGCAGCGTTGCATTAAGCTAGTCGTTCTTTGCAGTACGCTGTAAGTTCTATGCTGGCCGATCGC

    CTAGCATGCGGATTACTAAGACGCTATAGTCACATGCGCAACCAGCACCCTATGGGCGACCCGCTTTGT

    TCGGACCCTAACGATCGATCGATTGGACT5

    GRUP4

    3GGGCTAATAACGATCGATCGATCAGATGACGCGCGTCGCACGTATAGAGATGCTGGGGTGTACAGC

    CGATCGCCTAGCATGCGTTGACTATCGGCTACGTGACCGCATACTGTAGGCCCGCTAACGAGATCGAA

    GTGTTATACTGACGTAATTCGATCAGCAAATT5

  • Del DNA a les protenes 46 Material per als professors

    GRUP 5

    3TGATGCATTAAGCTAGTCGTTAGCCAGCGGCGTGCTATAACGATCGATCGATTACTGCGCGCGCCTAT

    AATACTTATGTACGTAAGACGAGTAGACCCGCAGGGGCGTGTGTGCTTAGGATGGGTAACTGGTCGCC

    GATCGCCTAGCATGCCAGTAGACACGAATC5

    6) Els tRNA units al seu aminocid. Shan dimprimir els tRNA i escriure darrera laminocid

    que li correspon (amb la lletra sobresaltada).

    Alanina

    asparagina (B)

    Cistena

    ciD glutmic

    trEonina

    Fenilalanina

    Glicina

    Histidina

    Isoleucina

    Leucina

    Metionina

    argiNina

    tirOsina

    Prolina

    lisina (Q)

    cid aspRtic

    Serina

    Triptfan

    glUtamina

    Valina

  • 47 Material per als professors

    C

    C C G G

    G G

    C G

    U A

    C

    Alanina Alanina

    Alanina Alanina

  • Del DNA a les protenes 48 Material per als professors

    C U A

    cid

    aspRtic

    C U G

    cid

    aspRtic

  • 49 Material per als professors

    C C A A A G

    Cistena

    Cistena

  • Del DNA a les protenes 50 Material per als professors

    C C C U U U

    ciD glutmic

    ciD glutmic

  • 51 Material per als professors

    A A A A A G

    Fenilalanina

    Fenilalanina

  • Del DNA a les protenes 52 Material per als professors

    A

    U U

    U

    U

    U G G

    G

    G

    G C

    trEonina trEonina

    trEonina trEonina

  • 53 Material per als professors

    C C C

    Glicina

    C C U

    Glicina

    C C A

    Glicina

    C C G

    Glicina

  • Del DNA a les protenes 54 Material per als professors

    G G G U U A

    Histidina Histidina

  • 55 Material per als professors

    U

    U

    U

    A A

    A

    A

    G

    U

    Isoleucina

    Isoleucina

    Isoleucina

  • Del DNA a les protenes 56 Material per als professors

    A A A

    A

    A

    G G G

    G

    G

    U

    C

    Leucina Leucina

    Leucina Leucina

  • 57 Material per als professors

    A U C

    Metionina

  • Del DNA a les protenes 58 Material per als professors

    A G G

    G

    G

    G C

    C C

    C

    C U

    argiNina argiNina

    argiNina argiNina

  • 59 Material per als professors

    A A A

    U U G

    tirOsina tirOsina

  • Del DNA a les protenes 60 Material per als professors

    G G G

    G G G G

    G G U

    C A

    Prolina Prolina

    Prolina Prolina

  • 61 Material per als professors

    U U U U U C

    lisina

    (Q)

    lisina

    (Q)

  • Del DNA a les protenes 62 Material per als professors

    U U C C A G

    Asparagina

    (B)

    Asparagina

    (B)

  • 63 Material per als professors

    A A

    A

    A

    A

    G

    G G

    G

    G

    U

    C

    Serina

    Serina

    Serina Serina

  • Del DNA a les protenes 64 Material per als professors

    A C C

    Triptfan

  • 65 Material per als professors

    G U U G U C

    glUtamina

    glUtamina

  • Del DNA a les protenes 66 Material per als professors

    C A C C A G

    C A U

    C A A

    Valina

    Valina

    Valina

    Valina

  • 67 Material per als professors

    A U U

    A U C

    A C U

    STOP STOP

    STOP

  • Del DNA a les protenes 68 Material per als professors

    Cursa de relleus del codi gentic En grups hauran de completar les segents taules. Tots els grups comenaran per la taula 1,

    que estar a un determinat lloc de la classe. El primer membre de cada grup haur danar fins

    all i omplir el primer requadre. Un cop acabat tornar amb el seu grup i aleshores el segon

    membre podr anar a omplir el segon requadre, i aix successivament. Quan sacabi la primera

    taula (esperarem que tots els grups hagin acabat) la corregirem i comenarem amb la segent

    taula. Guanyar lequip que primer hagi acabat (i correctament!) ms taules.

    Taula 1

    DNA (5 3)

    DNA (3 5)

    mRNA (cod)

    tRNA (anticod)

    Aminocid

    ___ ___ ___

    ___ ___ ___

    ___ ___ ___

    ___ ___ ___

    Met

    T ___ ___

    ___ ___ ___

    ___ G A

    ___ ___ ___

    ___

    ___ ___ ___

    C A ___

    ___ ___ U

    ___ ___ ___

    ___

    ___ ___ ___

    ___ ___ T

    ___ ___ ___

    A U ___

    ___

    Taula 2

    DNA (5 3)

    DNA (3 5)

    mRNA (cod)

    tRNA (anticod)

    Aminocid

    T C ___

    ___ ___ ___

    ___ ___ G

    ___ ___ ___

    ___

    ___ ___ ___

    ___ ___ ___

    ___ ___ ___

    ___ ___ ___

    Asn

    ___ ___ ___

    ___ T ___

    C ___ U

    ___ ___ ___

    ___

    ___ ___ ___

    ___ ___ ___

    G ___ ___

    ___ C C

    ___

    Taula 3

    DNA (5 3)

    DNA (3 5)

    mRNA (cod)

    tRNA (anticod)

    Aminocid

    A C G

    ___ ___ ___

    ___ ___ ___

    ___ ___ ___

    ___

    ___ ___ ___

    ___ ___ ___

    ___ A A

    G ___ ___

    ___

    ___ ___ ___

    G ___ ___

    ___ A ___

    ___ ___ G

    ___

    ___ ___ ___

    ___ ___ ___

    ___ ___ ___

    ___ ___ A

    Asp

    Taula 4

    DNA (5 3)

    DNA (3 5)

    mRNA (cod)

    tRNA (anticod)

    Aminocid

    ___ ___ T

    ___ ___ ___

    G ___ ___

    ___ A ___

    ___

    ___ ___ ___

    ___ ___ ___

    ___ ___ ___

    ___ ___ G

    Ile

    ___ ___ ___

    G ___ ___

    ___ A ___

    ___ ___ G

    ___

    A ___ ___

    ___ A ___

    ___ ___ ___

    ___ ___ U

    ___

  • 69 Material per als professors

    Taula 1 correcci

    DNA (5 3)

    DNA (3 5)

    mRNA (cod)

    tRNA (anticod)

    Aminocid

    ATG

    TAC

    AUG

    UAC

    Met

    TGA

    ACT

    UGA

    ACU

    Stop

    GTT

    CAA

    GUU

    CAA

    Val

    TAA

    ATT

    UAA

    AUU

    Stop

    Taula 2 correcci

    DNA (5 3)

    DNA (3 5)

    mRNA (cod)

    tRNA (anticod)

    Aminocid

    TCG

    AGC

    UCG

    AGC

    Ser

    AAT

    TTA

    AAU

    UUA

    Asn

    CAT

    GTA

    CAU

    GTA

    His

    GGG

    CCC

    GGG

    CCC

    Gly

    Taula 3 correcci

    DNA (5 3)

    DNA (3 5)

    mRNA (cod)

    tRNA (anticod)

    Aminocid

    ACG

    TGC

    ACG

    UGC

    Thr

    CAA

    GTT

    CAA

    GUU

    Gln

    CAC

    GTG

    CAC

    GUG

    His

    GAT

    CTA

    GAU

    CUA

    Asp

    Taula 4 correcci

    DNA (5 3)

    DNA (3 5)

    mRNA (cod)

    tRNA (anticod)

    Aminocid

    GTT

    CAA

    GUU

    CAA

    Val

    ATC

    TAG

    AUC

    UAG

    Ile

    CAC

    GTG

    CAC

    GUG

    His

    ATA

    TAT

    AUA

    UAU

    Ile