Lipasa. Información General Se produce generalmente en el páncreas, tambien se encuentran en la...
-
Upload
xavier-del-rio-montoya -
Category
Documents
-
view
227 -
download
0
Transcript of Lipasa. Información General Se produce generalmente en el páncreas, tambien se encuentran en la...
![Page 1: Lipasa. Información General Se produce generalmente en el páncreas, tambien se encuentran en la boca y el estomago.](https://reader033.fdocuments.mx/reader033/viewer/2022051216/5665b4b91a28abb57c93865a/html5/thumbnails/1.jpg)
Lipasa
![Page 2: Lipasa. Información General Se produce generalmente en el páncreas, tambien se encuentran en la boca y el estomago.](https://reader033.fdocuments.mx/reader033/viewer/2022051216/5665b4b91a28abb57c93865a/html5/thumbnails/2.jpg)
Información General
• Se produce generalmente en el páncreas, tambien se encuentran en la boca y el estomago.
![Page 3: Lipasa. Información General Se produce generalmente en el páncreas, tambien se encuentran en la boca y el estomago.](https://reader033.fdocuments.mx/reader033/viewer/2022051216/5665b4b91a28abb57c93865a/html5/thumbnails/3.jpg)
Lipasa enzima 3.1.1.3• Pertenece a la clase Hidrolasa y actúa sobre los enlaces éster.
Enzimas [BR: ko01000]3. Hidrolasas
3.1 Actuar sobre los enlaces éster 3.1.1 hidrolasas carboxílicos-éster
3.1.1.3 triacilglicerol lipasa
![Page 4: Lipasa. Información General Se produce generalmente en el páncreas, tambien se encuentran en la boca y el estomago.](https://reader033.fdocuments.mx/reader033/viewer/2022051216/5665b4b91a28abb57c93865a/html5/thumbnails/4.jpg)
ESTRUCTURA
Secuencia proteicaSecuencia de aminoácidos
(En humanos)Sitio activo
![Page 5: Lipasa. Información General Se produce generalmente en el páncreas, tambien se encuentran en la boca y el estomago.](https://reader033.fdocuments.mx/reader033/viewer/2022051216/5665b4b91a28abb57c93865a/html5/thumbnails/5.jpg)
Secuencia proteica(en el humano) atgctgccactttggactctttcactgctgctgggagcagtagcaggaaaagaagtttgctacgaaagactcggctgcttcagtgatgactccccatggtcaggaattacggaaagacccctccatatattgccttggtctccaaaagatgtcaacacccgcttcctcctatatactaatgagaacccaaacaactttcaagaagttgccgcagattcatcaagcatcagtggctccaatttcaaaacaaatagaaaaactcgctttattattcatggattcatagacaagggagaagaaaactggctggccaatgtgtgcaagaatctgttcaaggtggaaagtgtgaactgtatctgtgtggactggaaaggtggctcccgaactggatacacacaagcctcgcagaacatcaggatcgtgggagcagaagtggcatattttgttgaatttcttcagtcggcgttcggttactcaccttccaacgtgcatgtcattggccacagcctgggtgcccacgctgctggggaggctggaaggagaaccaatgggaccattggacgcatcacagggttggacccagcagaaccttgctttcagggcacacctgaattagtccgattggaccccagcgatgccaaatttgtggatgtaattcacacggatggtgcccccatagtccccaatttggggtttggaatgagccaagtcgtgggccacctagatttctttccaaatggaggagtggaaatgcctggatgtaaaaagaacattctctctcagattgtggacatagacggaatctgggaagggactcgagactttgcggcctgtaatcacttaagaagctacaaatattacactgatagcatcgtcaaccctgatggctttgctggattcccctgtgcctcttacaacgtcttcactgcaaacaagtgtttcccttgtccaagtggaggctgcccacagatgggtcactatgctgatagatatcctgggaaaacaaatgatgtgggccagaaattttatctagacactggtgatgccagtaattttgcacgttggaggtataaggtatctgtcacactgtctggaaaaaaggttacaggacacatactagtttctttgttcggaaataaaggaaactctaagcagtatgaaattttcaagggcactctcaaaccagatagtactcattccaatgaatttgactcagatgtggatgttggggacttgcagatggttaaatttatttggtataacaatgtgatcaacccaactttacctagagtgggagcatccaagattatagtggagacaaatgttggaaaacagttcaacttctgtagtccagaaaccgtcagggaggaagttctgctcaccctcacaccgtgttag
![Page 6: Lipasa. Información General Se produce generalmente en el páncreas, tambien se encuentran en la boca y el estomago.](https://reader033.fdocuments.mx/reader033/viewer/2022051216/5665b4b91a28abb57c93865a/html5/thumbnails/6.jpg)
Secuencia de aminoácidos(En el humano)
• MLPLWTLSLLLGAVAGKEVCYERLGCFSDDSPWSGITERPLHILPWSPKDVNTRFLLYTNENPNNFQEVAADSSSISGSNFKTNRKTRFIIHGFIDKGEENWLANVCKNLFKVESVNCICVDWKGGSRTGYTQASQNIRIVGAEVAYFVEFLQSAFGYSPSNVHVIGHSLGAHAAGEAGRRTNGTIGRITGLDPAEPCFQGTPELVRLDPSDAKFVDVIHTDGAPIVPNLGFGMSQVVGHLDFFPNGGVEMPGCKKNILSQIVDIDGIWEGTRDFAACNHLRSYKYYTDSIVNPDGFAGFPCASYNVFTANKCFPCPSGGCPQMGHYADRYPGKTNDVGQKFYLDTGDASNFARWRYKVSVTLSGKKVTGHILVSLFGNKGNSKQYEIFKGTLKPDSTHSNEFDSDVDVGDLQMVKFIWYNNVINPTLPRVGASKIIVETNVGKQFNFCSPETVREEVLLTLTP
![Page 7: Lipasa. Información General Se produce generalmente en el páncreas, tambien se encuentran en la boca y el estomago.](https://reader033.fdocuments.mx/reader033/viewer/2022051216/5665b4b91a28abb57c93865a/html5/thumbnails/7.jpg)
FUNCION
Sustratoproducto
inhibidores/activadorespH y temperatura óptima
![Page 8: Lipasa. Información General Se produce generalmente en el páncreas, tambien se encuentran en la boca y el estomago.](https://reader033.fdocuments.mx/reader033/viewer/2022051216/5665b4b91a28abb57c93865a/html5/thumbnails/8.jpg)
Sustrato• Triacilglicerol
• agua
![Page 9: Lipasa. Información General Se produce generalmente en el páncreas, tambien se encuentran en la boca y el estomago.](https://reader033.fdocuments.mx/reader033/viewer/2022051216/5665b4b91a28abb57c93865a/html5/thumbnails/9.jpg)
productos• Diacilglicerol
• Carboxilato
![Page 10: Lipasa. Información General Se produce generalmente en el páncreas, tambien se encuentran en la boca y el estomago.](https://reader033.fdocuments.mx/reader033/viewer/2022051216/5665b4b91a28abb57c93865a/html5/thumbnails/10.jpg)
Reacción
𝑡𝑟𝑖𝑎𝑐𝑖𝑙𝑔𝑙𝑖𝑐𝑒𝑟𝑜𝑙+𝑎𝑔𝑢𝑎↔𝑑𝑖𝑎𝑐𝑖𝑙𝑔𝑙𝑖𝑐𝑒𝑟𝑜𝑙+𝑐𝑎𝑟𝑏𝑜𝑥𝑖𝑙𝑎𝑡𝑜
![Page 11: Lipasa. Información General Se produce generalmente en el páncreas, tambien se encuentran en la boca y el estomago.](https://reader033.fdocuments.mx/reader033/viewer/2022051216/5665b4b91a28abb57c93865a/html5/thumbnails/11.jpg)
Maltasa ENZYMA: 3.2.1.20
![Page 12: Lipasa. Información General Se produce generalmente en el páncreas, tambien se encuentran en la boca y el estomago.](https://reader033.fdocuments.mx/reader033/viewer/2022051216/5665b4b91a28abb57c93865a/html5/thumbnails/12.jpg)
Una enzima que cataliza la hidrólisis de la maltosa en glucosa
![Page 13: Lipasa. Información General Se produce generalmente en el páncreas, tambien se encuentran en la boca y el estomago.](https://reader033.fdocuments.mx/reader033/viewer/2022051216/5665b4b91a28abb57c93865a/html5/thumbnails/13.jpg)
Enzymes 3. Hydrolases 3.2 Glycosylases 3.2.1 Glycosidases, i.e. enzymes that hydrolyse O- and S-glycosyl compounds 3.2.1.20 alpha-glucosidase
![Page 14: Lipasa. Información General Se produce generalmente en el páncreas, tambien se encuentran en la boca y el estomago.](https://reader033.fdocuments.mx/reader033/viewer/2022051216/5665b4b91a28abb57c93865a/html5/thumbnails/14.jpg)
![Page 15: Lipasa. Información General Se produce generalmente en el páncreas, tambien se encuentran en la boca y el estomago.](https://reader033.fdocuments.mx/reader033/viewer/2022051216/5665b4b91a28abb57c93865a/html5/thumbnails/15.jpg)
• Enzymes 3. Hydrolases 3.2 Glycosylases 3.2.1 Glycosidases, i.e. enzymes that hydrolyse O- and S-glycosyl compounds 3.2.1.20 alpha-glucosidase
![Page 16: Lipasa. Información General Se produce generalmente en el páncreas, tambien se encuentran en la boca y el estomago.](https://reader033.fdocuments.mx/reader033/viewer/2022051216/5665b4b91a28abb57c93865a/html5/thumbnails/16.jpg)
![Page 17: Lipasa. Información General Se produce generalmente en el páncreas, tambien se encuentran en la boca y el estomago.](https://reader033.fdocuments.mx/reader033/viewer/2022051216/5665b4b91a28abb57c93865a/html5/thumbnails/17.jpg)
Enzima Producido en
Sitio de liberación
Nivel de pH
Digestión de los carbohidratos
Maltasa Intestino delgado
Intestino delgado
Básico
![Page 18: Lipasa. Información General Se produce generalmente en el páncreas, tambien se encuentran en la boca y el estomago.](https://reader033.fdocuments.mx/reader033/viewer/2022051216/5665b4b91a28abb57c93865a/html5/thumbnails/18.jpg)
Usos de la maltasa• 1.Puede servir como un mecanismo de suplemento y apoyo
para el malestar digestivo de los niños autistas • 2. Puede servir como un mecanismo de prevención y apoyo
para la diarrea crónica • 3. Prevención del malestar digestivo asociado con trastornos
digestivos congénitos
![Page 19: Lipasa. Información General Se produce generalmente en el páncreas, tambien se encuentran en la boca y el estomago.](https://reader033.fdocuments.mx/reader033/viewer/2022051216/5665b4b91a28abb57c93865a/html5/thumbnails/19.jpg)
![Page 20: Lipasa. Información General Se produce generalmente en el páncreas, tambien se encuentran en la boca y el estomago.](https://reader033.fdocuments.mx/reader033/viewer/2022051216/5665b4b91a28abb57c93865a/html5/thumbnails/20.jpg)
![Page 21: Lipasa. Información General Se produce generalmente en el páncreas, tambien se encuentran en la boca y el estomago.](https://reader033.fdocuments.mx/reader033/viewer/2022051216/5665b4b91a28abb57c93865a/html5/thumbnails/21.jpg)
anexos
Digestión de enzimas
• https://www.facebook.com/l.php?u=https%3A%2F%2Fwww.youtube.com%2Fwatch%3Fv%3DXq6QmBzYaeA&h=hAQHpIqJH
• https://www.facebook.com/l.php?u=https%3A%2F%2Fwww.youtube.com%2Fwatch%3Fv%3DPPv_H6qGkIA&h=hAQHpIqJH
![Page 22: Lipasa. Información General Se produce generalmente en el páncreas, tambien se encuentran en la boca y el estomago.](https://reader033.fdocuments.mx/reader033/viewer/2022051216/5665b4b91a28abb57c93865a/html5/thumbnails/22.jpg)
referencia• Referencia EDU. (2013). University of Maryland Medical
Center. Obtenido de La Lipasa: http://umm.edu/health/medical/altmed/supplement/lipase
• JO, C., Hauptman, J., Anderson, J., Fuijoka, K., Smith, D., Zavoral, D., & Aronne, L. (2000). PubMED. Obtenido de Orlistat, un inhibidor de la lipasa, para mantener el peso después de la dieta convencional: un estudio de 1 y.: http://www.ncbi.nlm.nih.gov/pubmed/10357727
• KEGG. (2014). Kyoto Encyclopedia of Genes and Genomes. Obtenido de Enzyme: http://www.genome.jp/dbget-bin/www_bget?ec:3.1.1.3
• UniProt. (2014). UniProt.Job. Obtenido de http://www.uniprot.org/blast/?about=P16233[17-465]
![Page 23: Lipasa. Información General Se produce generalmente en el páncreas, tambien se encuentran en la boca y el estomago.](https://reader033.fdocuments.mx/reader033/viewer/2022051216/5665b4b91a28abb57c93865a/html5/thumbnails/23.jpg)
Referencias• KEGG. (2014). Kyoto Encyclopedia of Genes and Genomes.
Obtenido de Kyoto Encyclopedia of Genes and Genomes: http://www.genome.jp/dbget-bin/www_bget?ec:3.2.1.20