Post on 01-Nov-2020
Determinación del papel en la transmisión de malaria de las especies de Anopheles (Diptera: Culicidae) de dos localidades endémicas para malaria en Colombia
Juan Sebastián Durán Ahumada
Universidad Nacional de Colombia Facultad de Ciencias Agrarias
Escuela de Postgrados Maestría en Ciencias Agrarias Énfasis en Entomología
Bogotá, Colombia 2014
Determinación del papel en la transmisión de malaria de las especies de Anopheles (Diptera: Culicidae) de dos localidades endémicas para malaria en Colombia
Juan Sebastián Durán Ahumada
Tesis presentada como requisito parcial para optar al título de: Magister en Ciencias Agrarias
Directora: Helena L. Brochero M.Sc., PhD.
Facultad de Agronomía, sede Bogotá UNAL
Línea de Investigación: Entomología
Grupo de Investigación: Entomología - UNAL
Universidad Nacional de Colombia Facultad de Ciencias Agrarias
Escuela de Postgrados Maestría en Ciencias Agrarias Énfasis en Entomología
Bogotá, Colombia 2014
A mi madre Elisa por el apoyo incondicional, el amor infinito y tanta paciencia,
A mi hermano Julio por las risas, el aprendizaje y la complicidad, A Dita por el cariño, la compañía, el apoyo y el consejo más oportuno,
A mi tía Fabi, a mi abuela Clara y a mi papá Yuceth por siempre estar presentes, A Humo y a Pili por ser tan grandes compañeros, amigos y maestros,
Y a mi abuelo Juan y sus abejas por presentarme el maravilloso mundo de los insectos
“Si amas al sol que te alumbra, tal vez amas y si amas al insecto que te muerde, amas”
Antonio Porchia
Agradecimientos
A la Doctora Helena Brochero. A la Doctora Jan E. Conn. A Pilar Jiménez y a Humberto Mosquera Jaramillo. A la Doctora Martha Lucía Quiñones. A la Secretaría de Salud del Meta y a sus técnicos, profesionales y personal de apoyo. A Jenny García, Diana Ortiz, Paola Rodríguez y Diana Suárez. A José Dolores Palacios y Jatney Palacios. A la población del corregimiento de Pacurita, Quibdó. A Martha Liliana Ahumada. A todo el Personal del Laboratorio de Entomología de la Facultad de Medicina, Universidad Nacional de Colombia-sede Bogotá. A Sara Bickersmith y a Naomi McKeon A Elizabeth Ruiz. A Robert Wirtz. A Luz Stella Buitrago y el equipo de la Secretaria Departamental de Salud del Meta. A la Universidad Nacional de Colombia - QuiPu 201010012197. Al Proyecto Malaria Vectors Biology in Brazil/Colombia: Genetics & Ecology - USA NIH AI 2R01AIO54139.
Resumen IX
Resumen
Anopheles es el único género de mosquitos (Diptera: Culicidae) capaz de transmitir Plasmodia, los parásitos causantes de la malaria en el ser humano, una enfermedad de gran relevancia e impacto en las zonas tropicales. En dos localidades Puerto Gaitán (Meta-Colombia, 2009) y el corregimiento de Pacurita (Quibdó-Chocó, Colombia, 2010) donde la malaria es endémica a pesar de las diferencias ecológicas, geográficas y demográficas entre ellas, se evaluaron aspectos biológicos y ecológicos en inmaduros y adultos de Anopheles spp., relacionados con su bionomía (actividad, comportamiento y tasa de picadura, infección natural con Plasmodia, sitios de cría, estacionalidad y distribución geográfica) como factores relevantes relacionados con su papel en la transmisión de malaria en cada localidad. En un estudio longitudinal, se recolectaron formas inmaduras en sitios de cría mediante el método del cucharón, se realizó captura nictameral de hembras silvestres mediante el uso de atrayente humano, las cuales fueron evaluadas por la técnica de ELISA (Enzyme linked immunosorbant assay) para detectar infección natural con Plasmodium falciparum, P. vivax-VK210 y P. vivax-VK247. La determinación taxonómica se basó en caracteres morfológicos y confirmación molecular (ADNmt COI región barcode) y se confirmó infección natural por Reacción en Cadena de la Polimersa (PCR). En Puerto Gaitán, Meta An. darlingi Root 1926 fue la especie más abundante pero solo se encontró naturalmente infectada por P. falciparum a An. albitarsis F (Brochero et. al. 2007). El espécimen infectado se encontró cerca al final de la temporada de lluvias, picando en el peridomicilio entre las 23-24hr en el barrio Paraíso Natural. Se encontraron hábitat para inmaduros en el área urbana para ambas especies y se observó que los ríos que bordean el municipio determinan inundaciones estacionales que contribuyen con sitios de cría aptos para ambas especies. En Pacurita, Quibdó, Chocó la especie más abundante correspondió a An. nuneztovari Gabaldón 1940 pero no resultó infectada por Plasmodia. Las excavaciones derivadas de extracción de oro constituyen sitios de cría permanente para esta especie. En esta localidad no se registró ningún espécimen del Complejo Albitarsis como se había reportado previamente. Los resultados de este trabajo son de aplicabilidad para la vigilancia en salud pública en ambas localidades dado que permiten orientar las estrategias de vigilancia epidemiología y de control de insectos vectores. En Puerto Gaitán se sugiere enfocar las estrategias de control hacia mosquitos adultos con telas impregnadas con insecticidas de larga duración y evaluar los cambios poblacionales en An. darlingi y An. albitarsis F. No obstante, debido a que esta última prefiere sitios de cría expuestos al sol, como los estanques piscícolas, deben realizarse acciones para el manejo de estos hábitats. En Pacurita, Chocó se sugiere que las
X Determinación del papel en la transmisión de malaria de las especies de Anopheles…
acciones de control para malaria se fortalezcan a través de la vigilancia epidemiológica y diagnóstico adecuado y tratamiento oportuno. Debido a que se asocia a la malaria como un factor ocupacional, pueden desarrollarse alternativas de protección individual y de atención temprana y oportuna. Este estudio también aporta al conocimiento de la biodiversidad característica de estas dos zonas ecogeográficas. Palabras clave: Anopheles, larvas, bionomía, malaria, Meta, Chocó, Pacífico,
Orinoquia.
Contenido XI
Contenido
Pág.
Resumen ...............................................................................................................................IX
Lista de figuras ................................................................................................................... XIII
Lista de tablas ..................................................................................................................... XV
Introducción............................................................................................................................ 1
Marco Teórico ........................................................................................................................ 3 Situación de la malaria en el mundo .............................................................................. 3 Situación de la malaria en Colombia ............................................................................. 3 Situación de la malaria en las zonas de estudio ........................................................... 4 Especies de Anopheles en Colombia ............................................................................ 5 Especies de Anopheles en las zonas de estudio .......................................................... 5
Relación de la malaria y sus vectores con los cambios en el uso del suelo y las actividades humanas ...................................................................................................... 6 La malaria y su impacto sobre la economía y el desarrollo .......................................... 7
Pregunta De Investigación..................................................................................................... 8
cuerpo de hipótesis ................................................................................................................ 8
Objetivos ................................................................................................................................ 9 Objetivo General ............................................................................................................. 9 Objetivos Específicos ..................................................................................................... 9
1. Capítulo 1. Aspectos De La Epidemiología De La Malaria Y Bionomía De Anopheles Spp., En El Corregimiento Pacurita, Quibdó, Chocó, 2010. ............................................... 11
1.1 Anopheles spp., (Diptera: Culicidae) in a small locality in the Chocó Biogeographic Region, Colombia................................................................................. 11
2. Capítulo 2. Bionomía de Anopheles spp. De Puerto Gaitán, Meta Colombia 2009. .. 29 2.1 Breeding sites of Anopheles spp. (Diptera: Culicidae) in the municipality of Puerto Gaitán - Meta, Colombia .............................................................................................. 29 2.1 Urban malaria vectors (Anopheles spp., Diptera: Culicidae) in Puerto Gaitán
municipality-Meta, Colombia ........................................................................................ 42
3. Discusiones Generales ................................................................................................ 55
4. Conclusiones y recomendaciones ............................................................................... 57 4.1 Conclusiones ..................................................................................................... 57 4.2 Recomendaciones ............................................................................................. 58
XII Determinación del papel en la transmisión de malaria de las especies de Anopheles…
Anexo A: Fotografías de sitios de cría del corregimiento de Pacurita, Quibdó (Choco, Colombia) 2010 .................................................................................................................... 59
Anexo B: Fotografías de Sitio y viviendas muestreadas de Puerto Gaitán (Meta, Colombia) 2009. ................................................................................................................... 61
Anexo C: Formularios empleados en campo y laboratorio. ................................................ 64
ANEXO D. Secuencia Barcode-COI de ejemplar An. albitarsis F infectado por P. falciparum capturado en Puerto Gaitán, Meta, Colombia ................................................... 67
Bibliografía ........................................................................................................................... 69
Contenido XIII
Lista de figuras
Pág. Figura A- 1. Casos de malaria/1000 habitantes en Colombia (WHO, 2013) ...................... 3
Figura A- 2. Proporción de casos de malaria por P. falciparum en Colombia (WHO, 2013)
............................................................................................................................................... 4
1. Anopheles spp., (Diptera: Culicidae) in a small locality in the Chocó Biogeographic Region, Colombia
Figura 1- 1. Pacurita (Corregimiento) localization, Quibdó, Colombia. ............................. 14
Figura 1- 2. Potential breeding sites and wildfemale HLC collection, Corregimiento de
Pacurita, Quibdó (Chocó, Colombia, 2010), Flooded forest type (n=2) not georefenced . 17
Figura 1- 3. An. nuneztovari mean hourly human biting activity on corregimiento Pacurita-
Quibdó (Chocó, Colombia, 2010) (N=188 individuals) ...................................................... 19
Figura 1- 4. An. nuneztovari biting rate on Pacurita across 2010.n=188. *Difference
among sample effort outdoor (2nights)/indoor (1 night), also notes the indoor ULV house-
spraying aforementioned .................................................................................................... 20
Figura 1- 5. Malaria; estimation of inoculation and incidence of P. falciparum and P. vivax
on Pacurita through 2010 ................................................................................................... 21
2.1. Breeding sites of Anopheles spp. (Diptera: Culicidae) in the Puerto
Gaitán municipality, Meta, Colombia
Figura 2.1-1. Puerto Gaitán (Meta, Colombia) (taken from Wikimedia Commons)........... 31
Figura 2.1-2. Seasonality of Anopheles spp. immature individuals in Puerto Gaitán (Meta,
Colombia)-2009. N=178...................................................................................................... 33
Figura 2.1-3. Anopheles spp. breeding sites on Puerto Gaitán (Meta, Colombia)-2009
(IDEAM, WMS services) ..................................................................................................... 34
Figura 2.1- 4. Breeding site clustering after CA. *temporal breeding site type;
DrainD=Drainage ditch, SmStr=Small stream, FishP=Fishpond, RivOF=Rivero overflow,
Mori=”Morichera”, RivMa=River Margin. (Breeding sites with abundances equal to 1
Anopheles spp. individual were not taken in count, n=17)................................................. 35
Figura 2.1- 5. Correspondence Analyses factor map; Anopheles spp. VS breeding sites
types.*temporal breeding site type; DrainD=Drainage ditch, SmStr=Small stream,
FishP=Fishpond, RivOF=Rivero overflow, Mori=”Morichera”, RivMa=River Margin
(Breeding sites with abundances equal to 1 individual were not taken in count) .............. 36
XIV Determinación del papel en la transmisión de malaria de las especies de Anopheles…
Figura 2.1- 6. Interaction network between Anopheles spp. and their breeding sites,
Puerto Gaitán-Meta (Colombia, 2009) .*temporal breeding site type; DrainD=Drainage
ditch, SmStr=Small stream, FishP=Fishpond, RivOF=Rivero overflow, Mori=”Morichera”,
RivMa=River Margin. Thickness of the connecting line represents connected Anopheles
spp. abundance to a specific breeding site, breeding site box thickness represents the
amount of all Anopheles spp. found there, and species box thickness represents a
species total abundance (Breeding sites with abundances equal to 1 individual were not
taken in count, n=17) .......................................................................................................... 37
2.2. Malaria vectors (Anopheles spp., Diptera:Culicidae) in Puerto Gaitán
municipality - Meta, Colombia Figura 2.2-1. Puerto Gaitán (Meta, Colombia) (Wikimedia Commons) ............................. 44
Figura 2.2- 2. Anopheles spp. HLC sampling points on Puerto Gaitán (Meta, Colombia)-
2009 (IDEAM, WMS services), see Tabla 2.2-1. for additional information. ..................... 47
Figura 2.2- 3. A-An. darlingi,B- An. albitarsis sl and C- An. braziliensis, hourly biting
activity on Puerto Gaitán – Meta (Colombia, 2009). *March captures were not taken in
count for final analyses ....................................................................................................... 48
Figura 2.2- 4. An. darlingi, An. braziliensis and An. albitarsis sl monthly nighttime biting
activity on Puerto Gaitán – Meta (Colombia, 2009). A. Indoor, B. Outdoor. *March
captures were not taken in count for final analyses ........................................................... 49
Figura 2.2- 5. PCR (rFAL1-rFAL2) gel electrophoresis; 1)100 bp DNA ladder; 2) Negative
PCR control; 3) Positive PCR control (P. falciparum 3D7 strain); 4) An. braziliensis; 5)
An. albitarsis F; 6) 100 bp DNA ladder. .............................................................................. 50
Pág
Contenido XV
Lista de tablas
Pág. 1. Anopheles spp., (Diptera: Culicidae) in a small locality in the Chocó
Biogeographic Region, Colombia
Tabla 1-1. Established breeding site categories (corr.Pacurita, Quibdó, Colombia) ........ 16
2.1. Breeding sites of Anopheles spp. (Diptera: Culicidae) in the Puerto Gaitán
municipality, Meta, Colombia
Tabla 2.1-1. Established breeding site categories for Puerto Gaitán (Meta, Colombia),
2009. ................................................................................................................................... 32
2.2. Malaria vectors (Anopheles spp., Diptera:Culicidae) in Puerto Gaitán
municipality - Meta, Colombia
. Tabla 2.2- 1. Anopheles spp. human landing catches on Puerto Gaitán-Meta (Colombia,
2009).*Not taken in count for final analyses and index calculations.................................. 47
Introducción
Los mosquitos del género Anopheles (Diptera: Culicidae), son insectos holometábolos, cuyos estados juveniles dependen del medio acuático para completar su ciclo de vida, los huevos son dejados directamente sobre la superficie acuática y las larvas tienen cuatro estadios antes de formar la pupa, de la cual emerge el individuo adulto (CDC, 2010). En primera instancia las larvas de géneros como Anopheles, Bironella y Chagasia son fácilmente distinguibles de otros en campo debido a su orientación paralela a la superficie acuática. Tras una observación más detallada, las larvas de Anopheles spp. se diferencian de las del género Chagasia en que no poseen proyección caudal prolongada en el lóbulo anterior de la placa espiracular (González & Carrejo, 2009), y se diferencian de las larvas del género Bironella en que poseen una seta mesotorácica 1-M palmeada y una seta protorácia 4-P más cercana de la seta 1-3-P que a la seta 5-P (WRBU). En cuanto a los adultos, éstos se diferencian de otros mosquitos debido a la elevación del ápice de su abdomen cuando se posan en una superficie y debido a las manchas oscuras y claras que presentan en las alas. Los machos no se alimentan de sangre en tanto que las hembras adultas son las que dependen de la ingesta y digestión de ésta para la maduración y postura de los huevos, las especies de Anopheles se alimentan generalmente durante la noche (Lehane, 1991). Algunas especies de mosquitos del género Anopheles pueden transmitir los agentes causales de la malaria al ser humano a través de su picadura. Los agentes causales de esta enfermedad infecciosa son parásitos del género Plasmodium, siendo las especies que la causan en el ser humano P. ovale, P. malariae, P. vivax y P. falciparum (WHO, 2012). De éstas especies del parasito, únicamente las tres últimas se encuentran en el nuevo mundo, siendo P. falciparum la que produce el tipo de malaria potencialmente letal, la cual se halla en muchas regiones tropicales y subtropicales del mundo (WHO, 2012). P. vivax, no produce una malaria tan severa como P. falciparum, pero supone otras dificultades debido a que en los casos de infección por éste parásito son muy comunes las recidivas (recaídas), debido esto al mismo ciclo de vida de ésta especie (PAHO, 2006). Para esta enfermedad no existen vacunas licenciadas en la actualidad, aunque una gran cantidad de candidatas se encuentran en ensayos 0clínicos, solo una de estas se encuentra en fase 3 de ensayo (RTS,S/AS01) y existe una veintena más en fases 1 y 2 (WHO, 2012). Más del 85% del área de Colombia presenta características ideales para la transmisión de la malaria (Mendoza, Nicholls, Olano, & Cortés, 2000). Debido a
2 Determinación del papel en la transmisión de malaria de las especies de Anopheles…
que la mortalidad y especialmente la morbilidad asociadas a esta enfermedad presentan un alto impacto en países tropicales y a la inexistencia de una vacuna eficaz contra ésta, el estudio de los aspectos del componente entomológico de la transmisión de la enfermedad y la subsecuente aplicación de este conocimiento a la formulación de estrategias de control y prevención, referentes a éste componente, cobran una alta importancia para lograr la disminución en la incidencia de la malaria en las poblaciones humanas en riesgo. La presente propuesta busca determinar cómo algunos aspectos de la biología de las especies de Anopheles podrían explicar su importancia como vectores de malaria en dos localidades con diferentes características, con transmisión y alto riesgo de malaria, como lo son Puerto Gaitán (Meta) y el corregimiento de Pacurita (Quibdó, Chocó).
Determinación del papel en la transmisión de malaria de las especies de Anopheles 3
Marco Teórico
Situación de la malaria en el mundo
La malaria continua siendo una de las mayores causas de morbilidad y mortalidad en países tropicales y subtropicales del mundo, particularmente en África (WHO, 2012), se estima que alrededor de 3,3 billones de personas en el mundo se encuentran en riesgo de contraerla (CDC, 2012). La Organización Mundial de la Salud estimo que los parásitos causantes de malaria infectaron a 207 millones de personas (rango de incertidumbre de 135 millones - 287 millones) y causaron la muerte de alrededor de 627 mil personas (rango de incertidumbre de 473 mil – 789 mil) (WHO, 2013).
Situación de la malaria en Colombia
Figura A- 1. Casos de malaria/1000 habitantes en Colombia (WHO, 2013)
La malaria ha re-emergido recientemente como una problemática de salud pública en Colombia y parece ser climático dependiente (Ruiz, et al., 2006; Poveda & Rojas, 1997; Bouma, et al., 1997), factor que aunado a la presión del
4 Determinación del papel en la transmisión de malaria de las especies de Anopheles…
ser humano sobre los ecosistemas (debido al uso intensivo del suelo) contribuye con nuevos sitos de cría para los mosquitos y complejizan los escenarios relacionados de transmisión de la malaria (Ayala, et al., 2009; Tadei, Thatcher, Santos, Scarpassa, Rodrigues, & Rafael, 1998). Se estima que en Colombia más de 5 millones de habitantes viven en zonas de transmisión endémica (Ruiz, et al., 2006; WHO, 2013) y que más del 60% de la población se encuentra en riesgo de enfermar o morir por esta enfermedad (Ahumada M. , 2009). En 23 países del mundo, incluyendo a Colombia, se ha evidenciado resistencia al tratamiento con cloroquina para infecciones con P. vivax (WHO, 2012). En general, la especie parasitaria predominante en Colombia es el P. vivax con 73% en comparación con el 23% de P. falciparum (WHO, 2013), cuestión que puede variar entre las principales regiones de transmisión de malaria del país (Padilla, Álvarez, Montoya, Chaparro, & Herrera, 2011).
Figura A- 2. Proporción de casos de malaria por P. falciparum en Colombia (WHO, 2013)
Situación de la malaria en las zonas de estudio
Trabajos previamente publicados apuntan a que existe transmisión urbana de malaria en Puerto Gaitán (Meta, Colombia) y a que hay un incremento en la incidencia de la infección por las dos especies de Plasmodium presentes allí, estos hechos son más preocupantes si se tiene en cuenta la ocurrencia de dos casos mortales durante el año 2009 (Buitrago, Brochero, McKeon, Lainhart, & Conn, 2013). El escenario de la malaria parece ser más complejo debido a factores como la migración no planificada originada por el “boom” petrolero que se ha venido dando en la región y a la urbanización, los cambios graduales y repentinos sobre el medio ambiente derivados de las actividades humanas, el desplazamiento forzado causado por el conflicto armado que tiene lugar en los alrededores y la adyacencia de este centro urbano a los departamentos de Vichada y Casanare, ambos con alta transmisión de P. vivax y P. falciparum durante el período estudiado (Sivigila, 2009).
Determinación del papel en la transmisión de malaria de las especies de Anopheles 5
En el corregimiento de Pacurita (Chocó, Quibdó, Colombia) aparentemente existe transmisión endémica de la malaria, documentada en casos reportados a las autoridades de salud, casos comunicados por la comunidad, además de un caso documentado por uno de los técnicos de malaria durante el 2010, este último era por infección con P. falciparum de una joven de 19 años en avanzado estado de embarazo (Comunicación personal). La población de este corregimiento vive bajo condiciones precarias y en su mayoría habita casas construidas de madera, las cuales son muy proclives al ingreso de vectores, hecho que aunado con la generación de sitios de cría de Anopheles spp. por actividades mineras, complejiza el escenario local de la malaria.
Especies de Anopheles en Colombia
Se registran entre 40 y 47 especies de anofelinos para Colombia (González & Carrejo, 2009; Montoya-Lerma, et al., 2011), no todas estas especies son vectores de malaria, de las especies presentes en el país se consideran como vectores primarios de malaria a An. darlingi, An. albimanus y An. nuneztovari; cabe anotar que varias de las especies ostentan características que los convierten en vectores regionales o auxiliares como An. marajoara, An. pseudopunctipennis, An. neivai, An. rangeli, An. calderoni, An. neomaculipalpus, An. oswaldoi, entre otros (Herrera, Suárez, Sánchez, Quiñones, & Herrera, 1987; Olano, Brochero, Sáenz, Quiñones, & Molina, 2001; Quiñones, Ruiz, Calle, Harbach, Erazo, & Linton, 2006; Montoya-Lerma, et al., 2011). Las cualidades que pueden caracterizar a una especie como vector de malaria son; su capacidad de infectarse con los parásitos de la malaria (Herrera, Suárez, Sánchez, Quiñones, & Herrera, 1987), una abundancia relativa que le permita cierto nivel de contacto con el ser humano (Elliot, 1968), una alta preferencia por alimentarse del ser humano por encima de otras alternativas alimentarias (antropofilia) (Montoya-Lerma, et al., 2011), una longevidad que permita el desarrollo del ciclo del parasito dentro del mosquito hasta alcanzar su fase infecciosa para el ser humano (Moreno, Rubio-Palis, Páez, Pérez, & Sánchez, 2007), y por último un nivel de contacto entre sus individuos y el ser humano determinado por otros aspectos biológicos (p.ej. cercanía de sus sitios de cría a la población humana, relación entre el comportamiento de picadura y las actividades humanas).
Especies de Anopheles en las zonas de estudio
Para el departamento del Meta se reportan entre 24 y 25 especies de Anopheles, siendo An. darlingi el vector primario para ésta región (González & Carrejo 2009, Ahumada 2009). Entre las especies reportadas se incluyen algunas que hacen parte de complejos de especies –especies morfológicamente idénticas
6 Determinación del papel en la transmisión de malaria de las especies de Anopheles…
diferenciables a través de técnicas moleculares y/o citogenéticas- p.ej. An. marajoara, especie perteneciente al complejo Albitarsis (González & Carrejo 2009, Ahumada 2009) e incriminado como vector primario en una región de Brasil (Conn et.al. 2002) y como posible vector auxiliar en Villavicencio, Meta (Ministerio de Salud 1957, Herrera et.al. 1987, Brochero et. al. 2005). Para el departamento del Chocó se reportan alrededor de 21 o 22 especies de mosquitos del género Anopheles (Grupo de investigaciones entomológicas de la Universidad del Valle, 2005; González & Carrejo 2009). Estudios previos sugieren que los vectores que mantienen la transmisión de malaria urbana en Quibdó son An. darlingi y An. nuneztovari (Ochoa & Osorio 2006), aunque en otras áreas del Chocó se sugiere que la transmisión se mantiene por vectores como An. neivai (Murillo, Astaiza, & Fajardo, 1988; Murillo, Astaiza, & Fajardo, 1988; Murillo, Jaramillo, Quintero, & Suarez, 1989), An. albimanus e inclusive An. aquasalis (Olano, Brochero, Sáenz, Quiñones, & Molina, 2001).
Relación de la malaria y sus vectores con los cambios en el uso del suelo y las actividades humanas
Se ha observado que actividades como la migración humana y deforestación pueden alterar las dinámicas ecológicas de algunas especies relevantes para la transmisión de malaria, esto se ha observado en el aumento de la abundancia relativa de An. marajoara (An. albitarsis sl) con respecto del anteriormente prevalente An. darlingi, además de cambios en el comportamiento de picadura de estas especies y en la proporción de individuos de cada especie infectados con parásitos de la malaria; todo esto evidenciado tras alteraciones en el uso del suelo (reducción del hábitat boscoso por quema y tala) y aumento en las actividades de agricultura (generando sitios de cría ideales para la nueva especie predominante) en el estado de Amapá en Brazil (Conn, et al., 2002). En contraste, en la amazonia peruana se han hallado; gran cantidad sitios de cría viables y una tasa de picadura mayor para An. darlingi en zonas deforestadas, esto al compararlas con áreas boscosas (Vittor, et al., 2006; Vittor, et al., 2009). Actividades como la piscicultura pueden proveer hábitats ideales para las formas inmaduras de Anopheles spp., esto se ha evidenciado en localidades colombianas como Cimitarra (Santander) donde la mayoría de los sitios de cría en zonas rurales (88%) fueron estanques piscícolas y representaron el 40% en zonas urbanas, recolectándose en estos especies como An. triannulatus sl, An. nuneztovari, An. rangeli y en menor medida An. pseudopuntipennis (Brochero, Pareja, Ortiz, & Olano, 2006). En este tipo de criaderos y en otros estudios llevados a cabo en seis municipios del departamento del Meta, se registraron especies como An. darlingi, An. marajoara (An. albitarsis sl), An. rangeli, An. oswaldoi B y An. pseudopunctipennis, entre otros (Ahumada M. , 2009; Ahumada, Pareja, Buitrago, & Quiñones, 2013).
Determinación del papel en la transmisión de malaria de las especies de Anopheles 7
A pesar de estar caracterizada como una especie ribereña y asociada a sitios de cría naturales (Sinka, et al., 2010; Hiwat & Bretas, 2011), An. darlingi ha sido hallada en diversidad de hábitats intervenidos por el ser humano, entre estos se enumeran canales de irrigación, cultivos de arroz, cultivos de caña inundados y pastizales (Vittor, et al., 2009; Sinka, et al., 2010). Formas inmaduras de otras especies como An. albitarsis sl también se han reportado en cultivos de arroz (Sinka, et al., 2010). La actividad minera (oro) ha sido asociada a la transmisión de malaria en diversas áreas del sur de Venezuela, en asentamientos mineros; An. darlingi y An. marajoara (previamente incriminadas como vectores) fueron las especies más abundantes y ostentaron las mayores tasas de picadura (Moreno, Rubio-Palis, Páez, Pérez, & Sánchez, 2007). El intenso uso de insecticidas en asociado a actividades humanas como la agricultura puede disminuir el efecto de las estrategias de control vectorial, generando pérdida a la susceptibilidad a insecticidas, esto se ha documentado en diversos estudios para el vector africano de malaria An. gambiae (Bigoga, Ndangoh, Awono-Ambene, Patchoke, Fondjo, & Leke, 2012; Fane, Cissé, Traore, & Sabatier, 2012).
La malaria y su impacto sobre la economía y el desarrollo
La malaria supone costos substanciales tanto para el afectado y su círculo familiar (medicamentos, gastos de viajes, gastos clínicos, días perdidos de trabajo, ausentismo escolar, gastos en medidas preventivas, gastos funerarios en caso de muerte) como para el gobierno (mantenimiento de instalaciones de salud, compra de medicamentes y suministros, días perdidos de trabajo y la resultante disminución de ingresos, pérdida de oportunidades para proyectos económicos conjuntos y de turismo. Intervenciones; aplicación de insecticidas, distribución de toldillos tratados) (CDC, 2012). Sus consecuencias sociales son complejas y difíciles de discernir, de todos modos, esta enfermedad afecta desproporcionadamente a las personas pobres y vulnerables (Greenwood, Bojang, Whitty, & Targett, 2005; Wielgosz, Mangheni, Tsegai, & Ringler, 2012).
8 Determinación del papel en la transmisión de malaria de las especies de Anopheles…
Pregunta De Investigación
¿Qué los aspectos de la biología de las especies de Anopheles pueden explicar su importancia como vectores de malaria en zonas de estudio con diferentes características ambientales y poblacionales?
cuerpo de hipótesis
Cada localidad estará representada por una composición de especies con características biológicas particulares asociadas directamente con su ecología.
De acuerdo con datos históricos se registrará la presencia de An. darlingi y An. albitaris sl en ambas localidades. No obstante, cada población natural tendrá diferencias en su biología, tanto para formas inmaduras como adultas, determinadas por las características eco-geográficas propias de cada localidad.
Debido a que en ambas localidades la malaria es endémica, se encontrará infección natural por parásitos del género Plasmodium que causa malaria en humanos, en poblaciones naturales de las especies de Anopheles registradas para cada localidad.
A pesar de las diferencias eco-geográficas de Pacurita, Chocò y Puerto Gaitàn, Meta, las especies de Anopheles más abundantes tanto en formas inmaduras como adultas serán las que tienen un papel relevante como posibles vectores de malaria.
Determinación del papel en la transmisión de malaria de las especies de Anopheles 9
Objetivos
Objetivo General
Relacionar las especies de Anopheles halladas en las áreas de estudio con los aspectos biológicos determinantes de su papel como vectores de malaria en éstas áreas.
Objetivos Específicos
Determinar taxonómicamente las formas inmaduras y adultos silvestres de Anopheles encontradas en las localidades de estudio.
Determinar y comparar la infección natural por P. falciparum, P. Vivax VK210 y P. vivax 247 de las hembras silvestres de las distintas especies Anopheles recolectadas en las zonas de estudio
Establecer y comparar intrarregionalmente (p.ej. estacionalidad) e interregionalmente el comportamiento de picadura a humanos de las especies de Anopheles halladas en los sitios de estudio.
Relacionar las medidas de biodiversidad de las especies de Anopheles con las características observadas de sus sitios de cría, y comparar el modo en que sus formas inmaduras ocupan los criaderos entre las localidades estudiadas.
Establecer una aproximación de la importancia para la transmisión de malaria de las diferentes especies de Anopheles halladas en cada localidad a través de relacionar sus aspectos biológicos con aspectos epidemiológicos relevantes.
1. Capítulo 1. Aspectos De La Epidemiología De La Malaria Y Bionomía De Anopheles Spp., En El Corregimiento Pacurita, Quibdó, Chocó, 2010.
1.1 Anopheles spp., (Diptera: Culicidae) in a small locality in the Chocó Biogeographic Region,
Colombia
[Short communication written under Memórias do Instituto Oswaldo Cruz guidelines for short
communications]
Sebastián Durán1, Jan E. Conn
2,3, Helena Brochero
1*
1 Facultad de Agronomía, Universidad Nacional de Colombia, Bogotá DC, Colombia
2 Griffin Laboratory, Wadsworth Center, New York State Department of Health, Slingerlands, NY
12159, USA 3 Department of Biomedical Sciences, School of Public Health, State University of New York,
Albany, NY 12222, USA *Corresponding author
RUNNING TITLE “Mal. vectors in Chocó biogeographic´s loc.” ABSTRACT Chocó is one of the departments with the highest malaria burden brings in Colombia. Urban and rural areas of Quibdó municipality have the highest number of permanent inhabitants in the department and also a permanent floating population coming from malaria hyperendemic areas. Because urban malaria transmission has been reported on Quibdó this study was carried out for seven
12 Determinación del papel en la transmisión de malaria de las especies de Anopheles
months to provide insight into some biology aspects of local Anopheles spp. in Pacurita, a small town located 7km from Quibdó, where gold mining activities are generating enabling environments for new larval habitats. Anopheles breeding sites were indentified and characterized; and standard dipping method was used to collect immature forms; only 2 species were represented on the inspected breeding sites, An. nuneztovari Gabaldon 1940 (n=16; 3 Gold mining excavations –GME-) and An. darlingi Root 1926 (n=1; 1 GME). Human landing catch method (138 hours in indoor, 161 hours in outdoor) resulted on 7 species landing on human; An. apicimacula Dyar & Knab 1906 (n=1), An. darlingi (n=22), An. neivai Dyar & Knab 1913 (n=6), An. nuneztovari [n=188; indoor biting activity peaks 21-22H, 00-01H, 03-04H and 05-06H; outdoor biting activity showed activity peaks from 19-20H, 22-23H and 00-01H], An. oswaldoi sl Peryassu, 1922 (n=5), An. rangeli Gabaldon, Cova Garcia & Lopez, 1940 (n=9) and An. triannulatus sl Neiva & Pinto 1922 (n=13). Despite the fact that malaria cases occurred during this study, CS-protein ELISA assay did not detect any individuals infected with Plasmodium spp. Because of the observed biting activity of An. nuneztovari, considered a primary vector in Chocó, vector control could include long lasting insecticide-treated nets; use of repellants during outdoor and daytime activities, and strengthening accurate malaria diagnosis and early treatment at the local level. Keywords malaria Anopheles biology biting-activity Quibdó FINANCIAL SUPPORT USA-National Institutes of Health (AI 2R01AIO54139). Universidad Nacional de Colombia, Sede Bogotá (QuiPu 201010012197). INTRODUCTION Most of the inhabitants of Chocó department are Afro-Colombian and Indigenous people, and this region is endemic for malaria transmission, accounting for 12 fatal malaria cases from 2008 to 2010, 7 of which occurred in 2010 (Chaparro, 2012). Approximately 22 Anopheles species have been recorded for this department, including species important to malaria transmission in the Americas such as An. darlingi Root 1926, An. nuneztovari Gabaldón 1940 and An. albimanus Wiedemann 1920 (Servicio de Erradicacion de la Malaria, 1957; Herrera, Suárez, Sánchez, Quiñones, & Herrera, 1987; González & Carrejo, 2009; Ochoa & Osorio, 2006). In Quibdó, the capital city of Chocó Department, urban malaria transmission has been reported (Ochoa & Osorio, 2006), and An. darlingi and An. nuneztovari incriminated as vectors. It is noteworthy that the first record of susceptibility loss to DDT in An. darlingi was reported on Quibdó (Suarez, Quiñones, Palacios, & Carrillo, 1990). Urban and rural areas of Quibdó have the highest number of permanent inhabitants in the department and also have a permanent floating population migrants to Quibdo from hyperendemic malaria areas.
Capítulo 1 13
Pacurita, a small locality 7km from Quibdó, is topographically hilly surrounded by a relatively low disturbance forest environment (Pino & Valois, 2004 ), and exhibits a bimodal rainfall regime with a short and a poorly differentiated dry season (Hijmans, Cameron, Parra, Jones, & Jarvis, 2005). The Pacurita population of about 649 inhabitants is composed mostly of persons of African descent (POT - Quibdó, 2012), whose economic activities are placer gold-mining (artisanal and semi-industrial), unlicensed logging and small scale farming (banana, rice, corn); there is also fishing and hunting of minor species on a small scale. Quibdó inhabitants visit Pacurita on weekends for recreational purposes [ (POT - Quibdó, 2012), personal observations]. During this study there was not a public aqueduct system (installed in 2013) or sewage system; water for human consumption and household activities is obtained from the Pacurita River that runs alongside the western side of Pacurita and from Quebrada San Benito (a brook). Solid residues are not collected or properly managed and usually end up in backyards and in the aforementioned waterbodies (POT - Quibdó, 2012). Most of the houses are built of wood (less expensive alternative), and a few are constructed from bricks and concrete. Most people gather around house entrances at dusk and most of them keep the entrance door almost permanently open. There is a small pre-school center and an elementary school; secondary students need to go to school to Quibdó. The one health post is small, does not have basic equipment, supplies and drugs are scarce, and kept in inappropriate storage conditions, attention is sporadic and there is only one nurse in charge [ (POT - Quibdó, 2012), personal observation]. Besides malaria cases, the community exhibits skin rashes linked to water pollution from mercury (POT - Quibdó, 2012), a metal used in gold extraction activities. Flooding occurs 3 to 4 times per year, resulting from river level increases during the rainiest months, also damaging crops. There are environmental problems caused by semi-industrial gold mining machinery (dredgers, power shovels) that spill fuel and used motor oil and also cause sedimentation in the Pacurita River. This seven month study aimed to provide an insight into the biological aspects of Anopheles spp., particularly those that may be associated with placer gold mining activities in this locality. Additionally, although local health authorities have not registered any member of the Albitarsis Complex in Chocó, An. marajoara was detected in Pacurita (GenBank AY028127) (Sierra, Velez, & Linton, 2004), which is of particular interest due to records of members of this complex in dissimilar localities across Colombia. MATERIALS AND METHODS The study site, Pacurita (Fig.1-1) (4°40´N, 76°35´W) is a small township 7km from Quibdó (Chocó, Colombia), in the watershed of the Cabí river (POT - Quibdó, 2012). Mosquito collections were carried out from April to October (2010), 2 consecutive nights (18H to 06H) per month during new moon lunar phase or as
14 Determinación del papel en la transmisión de malaria de las especies de Anopheles
close as possible to it. Specimens were collected by HLC, using oral aspirators for 50 minutes per hour, from 18:00h to 6:00hr indoor (main room, halls or living/dining room) and outdoor (within 10 meters of the house), and collectors swapped places every hour to avoid bait bias (WHO, 1975). Temperature (°C) and relative humidity (%) were measured hourly. Human biting rate (per hour and per night) was calculated after taxonomic identification, and was defined as the amount of bites per person per night, the amount of bites per person per hour was also taken in count (Jiménez, Conn, Wirtz, & Brochero, 2012).
Figura 1- 1. Pacurita (Corregimiento) localization, Quibdó, Colombia.
Anopheles spp. wild-caught females were taken alive to the Laboratorio de Genética de Insectos insectary at Universidad Nacional de Colombia (Bogotá DC, Colombia) and blood-fed with Mus musculus to obtain isofamilies, which are intended to confirm taxonomic identification of the collected individuals. An isofamily is defined as a set of eggs, 4th instar larval molt, pupae molt and adult
Capítulo 1 15
forms obtained from a single egg batch (Fleming, 1986; Belkin, Schick, Galindo, & Aitken, 1967). Thus, blood-fed and unfed wild-females were subjected to forced oviposition as follows:, each female was anesthetized using ethyl-acetate and one wing and hind leg were removed (also kept) to induce oviposition, finally, the individual was allowed to float on the water surface in a small cup with water, to induce egg-laying (Estrada, et al., 2003). Unhatched eggs were stored in labeled plastic vials with 70%V/V ethanol; larvae were fed with ground dog food, the exuviae of fourth instar larvae and pupae were stored in plastic vials with 70%V/V ethanol, and adult individuals were stored in 1.5ml eppendorfs in a -20°C freezer. All the collectors signed an informed consent form explaining the aims and risks of the collection activity. Informed consent and collection protocol (#02-028a) were approved by the Institutional Review Board (IRB) of the New York State Department of Health (NYSDOH) and Universidad Nacional de Colombia. Wild-female blood feeding with Mus musculus was carried out following the Vertebrates handle protocols (Facultad de Medicina Veterinaria y Zootecnia, Universidad Nacional de Colombia), National Institute of Health (Assurance #A5791-01) and the New York State Department of Health (protocol #11-420). Taxonomic identification of the entomological material was carried out using dichotomous keys based on morphological characters (Faran M. , 1980; Faran & Linthicum, 1981; González & Carrejo, 2009; Rubio-Palis, 2000). Individual larvae that did not survive to 4th instar or heavily damaged individuals were unable to be identified to species level. HBR for each species was calculated as the number of female Anopheles spp. bites per person per night (Girod, Gaborit, Carinci, Issaly, & Fouque, 2008). Biting activity was observed from calculating the mean of the amount of Anopheles spp. bites per person per hour (Jiménez, Conn, Wirtz, & Brochero, 2012). To assess natural infection with human Plasmodia parasites, all the wild-caught females were tested for P. falciparum, P. vivax-210 and P. vivax-247 circumsporozoite protein using ELISA (Enzyme-Linked ImmunoSorbent Assay) (Wirtz R. , Burkot, Andre, Rosenberg, Collins, & Roberts, 1985; Wirtz R. , Burkot, Graves, & Andre, 1987; Wirtz R. , 2009); it was carried out using the kit provided by Center for Disease Control (CDC, Atlanta, USA), which contains the needed antibodies and positive controls. Thorax/head of the females were pooled according to species and collection period on 1,5ml sterile plastic vials for the first round of ELISA, and the cut-off (absorbance value above which a pool is considered as positive), for each plate, was defined as twice the mean absorbance of the negative controls made up of lab reared An. albimanus Buenaventura strain thorax/head (Wirtz R. , Burkot, Graves, & Andre, 1987). To confirm infection, a second ELISA assay was carried out using a single abdomen belonging to each pool positive for any of Plasmodia species and variants assayed with the first ELISA. Then, the CSP (Circumsporozoite) index was calculated as the proportion of postive mosquitoes for circumsporozoite protein of any of the assayed parasitical species (Girod, Gaborit, Carinci, Issaly, & Fouque,
16 Determinación del papel en la transmisión de malaria de las especies de Anopheles
2008). EIR (Entomological Inoculation Rate) was calculated as the number of infective bites that may be received by a person in a year, EIR=(bite/person/night)*365nights*CSP (MacDonald, 1957). Confirmed malaria cases (year 2010) were evaluated aiming to provide an insight on the disease dynamics through the sampling period, and to determine whether the occupations and age classes were positively correlated with malaria cases in Pacurita during 2010. Annual parasite index (API) was calculated for P. falciparum and P. vivax as follows API = (confirmed cases during 1 year/population under surveillance) x 1000. Age classes were defined as follows; <5, 5 – 14, 15 – 44 and ≥45 years old (Ochoa & Osorio, 2006). Gender correlation with malaria occurrence was also assessed. Malaria case sequence (date of symptom appearance, possible period in which the infective biting occurred, i.e., from 9 to 14 days before the onset of symptoms for P. falciparum and 12 to 17 days for P. vivax) (Brasil, et al., 2011; Warrell & Gilles, 2002) through the year was compared with changes on Anopheles spp. human biting rates. Malaria cases information was compiled from local health authorities, and the provided information did not contain any identifiers. Additionally, immature forms collections and breeding sites characterization were carried out, potential breeding sites were georeferenced with a Garmin eTrex® GPS device and points were taken using the WGS84 coordinate system. Whenever possible, variables such as estimated area (<10m2, 10-100m2 or >100m2), water temperature (ºC), water level 30cm away from the margin (cm), estimated distance to the closest home (m), sunlight exposure of the breeding site (full sunlit exposure, partial shade or total shade), associated vegetation types (emerging, surrounding and/or floating vegetation), water movement (fast, slow and none), water turbidity (clear, turbid), presence of organic material (WHO, 1975) and general observations of the surrounding landscape and fauna associated with the breeding site were measured. These sites were classified into 21 categories (Table 1-1.); based on origin, general environment and observed features;
Categories of the potential Breeding Sites
1. Lake, lagoon 8. Tree hole 15. Fallen fruit 2. Fishpond 9. Rock hole 16. Stem internode 3. River margin 10. Small stream 17. Water sump 4. Flooded pasture 11. Animal foot-print 18. Swamp 5. Flooded forest. 12. Car tire-print 19. Puddle 6. Drainage ditch 13. Crab hole 20. Artificial reservoir 7. Well, tank 14. Ricefield 21. “Jagüey” 22. Others (p.ej. gold mining excavations, small dam with pond)
Tabla 1-1. Established breeding site categories (corr.Pacurita, Quibdó, Colombia)
The standard dipper method (500ml) was followed to collect the Anopheles spp. immature forms (Service M. , 1993; WHO, 1975) from the breeding sites previously reported by local health authorities, each site was completely covered
Capítulo 1 17
taking 20 dives every 5 m. Immature forms collections were carried out monthly between April-October, 2010. Collected individuals were taken alive to the Laboratorio de Genética de Insectos´s breeding room (Universidad Nacional de Colombia, Bogotá DC, Colombia) and maintained a temperature ranging between 24°C and 27°C, relative humidity range 65%-72%, a 12H light/12H darkness photoperiod- and were fed with ground dog food to obtain adult forms for entomological series (Belkin, Schick, Galindo, & Aitken, 1967; WHO, 1975) for their taxonomic identification (Faran M. , 1980; Faran & Linthicum, 1981; González & Carrejo, 2009; Rubio-Palis, 2000). Emerged adult individuals were codified and individually stored on pierced plastic 1.5ml eppendorf tubes; tagged, grouped and bagged with silica gel desiccant in a -20ºC freezer. Exuviae of fourth instar larvae and pupae were stored in plastic vials in 70%V/V ethanol. RESULTS
Figura 1- 2. Potential breeding sites and wildfemale HLC collection, Corregimiento de Pacurita,
Quibdó (Chocó, Colombia, 2010), Flooded forest type (n=2) not georefenced
A total of thirteen possible breeding sites belonging to six categories were classified as follows: Car tire-print type breeding site was the result of the transit of
18 Determinación del papel en la transmisión de malaria de las especies de Anopheles
a heavy vehicle (reported once during this study); Fishpond type is an artificial breeding site derived from small scale pisciculture ponds; Gold mining excavation (GME) type refers to a breeding site resulting from soil excavation for placer gold mining activities; these are usually dug using heavy machinery like power shovels and dredgers. Flooded forest type refers to a forest environment area prone to flooding. Small dam with pond was represented by only one breeding site; it was a small human-made pond with a small dam with some succession process going on (evidenced on plant colonization) and presence of organic material. All inspected breeding sites were permanent with exception of Car tire-print type. An. darlingi (n=1) only was found in a gold mining excavation while An. nuneztovari (n=16) was found only in three breeding sites, a fishpond (n=1) and two gold mining excavation (n=15). Referring to the activity on the breeding sites trough the sampled year, only one breeding site, a GME was positive on May (Breedsite 7). On June three breeding sites were active: two GME, Breedsite 7 (2 An. spp individuals) and Breedsite 8 (An. nuneztovari=4, An. spp=5); one Fishpond corresponding to breedsite 9 with one An. nuneztovari and 2 An. spp. On July, just one GME was positive, breedsite 8, with 4 An. nuneztovari and one An. spp. On August, a GME was positive with just one An. darlingi individual. On October, one GME was positive, breedsite 1, with one individual that could not be identified because it only survived to 2nd instar of its development. Months like April and September showed no positive breeding sites (Data not shown). No female mosquitoes were collected resting indoor nor on the outdoor during the few and sporadic active searches. A total of 282 Anopheles spp. individuals were caught by HLC; An. nuneztovari was the most predominant species (66.6%, n=188), followed by An. darlingi (7.8%, n=22), An. triannulatus sl (4.6%, n=13), An. rangeli (3.2%, n=9), An. neivai (2.1%, n=6), An. oswaldoi sl (1.8%, n=5), An. apicimacula (0.4%, n=1) and Anopheles spp. (13.5%, n=38), the last corresponded to individuals that could not be fully identified due to specimen damage and lack of isofamilies. Additionally, total of 20 isofamilies was obtained. All the aforementioned wildfemale individuals were tested by ELISA assay for detecting the CS protein (Wirtz et.al. 1987, 1991, 1992) but no individual of any species was found infected with P. falciparum, P. vivax-VK210 and/or P. vivax-VK247. Thus CSP index and EIR were zero.
Capítulo 1 19
Figura 1- 3. An. nuneztovari mean hourly human biting activity on corregimiento Pacurita-Quibdó
(Chocó, Colombia, 2010) (N=188 individuals)
Differences in sample effort between indoor and outdoor were caused by occasional reluctance of some householders to allow the full 12 hour indoor sampling period. An. nuneztovari indoor biting activity showed peaks at 21-22H, 00-01H, 03-04H and a dawn peak at 05-06H; whereas outdoor biting activity showed activity peaks from 19-20H, 22-23H and 00-01H (Figura 1-3). An. darlingi (n=22) had two indoor activity peaks (20-21H, 22-23H) and 3 outdoor activity peaks (19-20H, 23-24H, 03-04H), and An. neivai (n=6) was found exclusively outdoor at different times of the night (from 18 to 21H, 22-23H and 05-06H) (Data not shown).
20 Determinación del papel en la transmisión de malaria de las especies de Anopheles
Figura 1- 4. An. nuneztovari biting rate on Pacurita across 2010.n=188. *Difference among sample
effort outdoor (2nights)/indoor (1 night), also notes the indoor ULV house-spraying aforementioned
Inhabitants and technicians of the local malaria program referred to a control intervention carried out during the studied period (first week of July, 2010), which consisted on an indoor ULV house-spraying with the organophosphate fenitrothion; further official information about this event (i.e. concentration) was not provided by official local health authorities. P. falciparum (17 cases) API for 2010 was 26.2 cases per 1000 inhabitants whereas P. vivax (3 cases) API was equal to 4.6 cases per 1000 inhabitants. 64.7% of P. falciparum cases occurred on the 15-44 years old age group while all the 3 P. vivax cases occurred on the same age group. Malaria occurred mostly on males, 64.7% for P. falciparum and 2 cases for P. vivax. About ethnicity, Afro-Colombian accounted for 100% of P. falciparum cases and 1 case on Indigenous for P. vivax was reported. No malaria cases for any pregnant woman were reported on the official epidemiological information, but during the study period the community communicated two cases to the staff, and an additional case of this type was observed by one of the hired technicians on a blood smear carried out in situ on July´s field job.
Capítulo 1 21
Figura 1- 5. Malaria; estimation of inoculation and incidence of P. falciparum and P. vivax on Pacurita
through 2010
Neither fatal malaria nor mixed malaria cases were reported during the studied period in this locality. The first P. vivax confirmed case in 2010 sought medical assistance in the last week of March, whereas the first P. falciparum confirmed case sought medical assistance during the first week of April. There were no malaria cases from January to February and from July to December. DISCUSSION Due to low diversity and abundances of immature stages on the breeding sites, it was not possible to carry out any significant spatial, ecological nor statistical analyses that might enable to assess any correlation to the measured environmental variables and general environmental observations in relation to Anopheles spp. immature forms. It is not possible to evaluate if gold mining activities carried out on the surroundings could be relevant to the apparition of significant larval habitats and changes on malaria dynamics (Moreno, Rubio-Palis, Páez, Pérez, & Sánchez, 2007). Moreover, oil derived products, like such as the onesthose spilled by heavy machinery used for semi-industrial gold mining activities, might also eventually produce cross- resistance to insecticides in Anopheles spp.. (Djouaka, et al., 2007). Breeding sites that were not sampled (inaccessible, unreported, bromeliads, among others) seem to be important to the species diversity and abundances found on the human landing catches. We recommend a broader study assessing the association between Anopheles spp. larvae and biotical features of their breeding sites, such as algae biomass estimation and/or assessing algal species composition (Kaufman, Wanja, Maknojia, Bayoh, Vulule, & Walker, 2006), as previously done for An. pseudopunctipennis (Rejmánkova et al. 1991). It is necessary to assess
22 Determinación del papel en la transmisión de malaria de las especies de Anopheles
association with more finely measured abiotic features for example water flow (m/s), better measures of shade, conductivity, pH, and salinity (McKeon, Schlichting, Povoa, & Conn, 2013), to provide more comprehensive knowledge of local vector immature stage bionomics. No Albitarsis Complex members were identified in this study, as might have been expected if only the ecoregional classification of malaria vectors proposed by Rubio-Palis & Zimmerman (1997) had been taken into account. However, we thought it would be worthwhile to try to collect in Pacurita because of the previous study that detected An. marajoara here (Sierra, Velez, & Linton, 2004). Two species recognized as primary vectors in Colombia were collected (An. darlingi and An. nuneztovari) as immature and adult forms, both are well adapted to breeding sites made by human, while other species considered as secondary vectors (An. neivai and An. rangeli) were collected as adults (Montoya-Lerma, et al., 2011; Olano, Brochero, Sáenz, Quiñones, & Molina, 2001; Servicio de Erradicacion de la Malaria, 1957). People can be exposed to biting of these species several times from dusk until dawn and malaria transmission seems to occur throughout the year. Based on the results reported above, it is not completely clear if An. nuneztovari is the main malaria vector on this periurban locality, further studies need to be carried out to assess so. Although, its previous incrimination on malaria transmission in Quibdó (Ochoa & Osorio, 2006), its relative high abundance and correlation between biting activity fluctuations (naturally caused or caused by control interventions) and observed disease epidemiology could point that it might be the main malaria vector. Nevertheless, other relevant factors for its importance as vector need to be studied, for example approximated vector survival rate, parous rates, age structure, among others (Koenraadt, Paaijmans, Schneider, Githeko, & Takken, 2006; Moreno, Rubio-Palis, Páez, Pérez, & Sánchez, 2007; Murillo, Jaramillo, Quintero, & Suarez, 1989). Brochero et.al. (2006) observed a very different period of maximum biting activity for this species (20-21H) on Cimitarra (Santander) (Brochero, Pareja, Ortiz, & Olano, 2006) and from 18 to 19H on Villavicencio-Meta (Brochero, Rey, Buitrago, & Olano, 2005); these differences could reflect distinctive features of this species that could be determined by differential evolutive pressures on the populations (interspecific competition for resources, behavioral heterogeneity of the human hosts, environmental factors, etc). According the study of Sierra et al. (2004) it is possible that the sampled population corresponds to a unique genetic species located at the western flank of the Andes and distributed across Chocó and Valle del Cauca. Additionally, An. nuneztovari has been associated to human made breeding sites, particularly fishponds near to dwellings (Brochero, Pareja, Ortiz, & Olano, 2006; Brochero, Rey, Buitrago, & Olano, 2005) generating more risk to human contact vector. Additionally to this type of breeding sites, in Pacurita this species was found well adapted in gold mining excavations where people stay working long time and they are exposing permanently to contact human-vector.
Capítulo 1 23
Because of their low abundance in this study; An. triannulatus sl, An. oswaldoi sl, An. darlingi, An. rangeli, An. apicimacula and An. neivai biting behaviors were not representative enough to describe patterns or to be compared with their behavior among other regions. Since An. neivai has been recorded biting humans during daylight (Montoya-Lerma, et al., 2011; Solarte, Hurtado, Gonzalez, & Alexander, 1996; Murillo, Astaiza, & Fajardo, 1988; Escovar, González, & Quiñones, 2013), this species could represent a risk to people during their daytime activities. A study of local daytime outdoor biting behavior and natural infectivity of An. neivai is recommended to have some insight into its potential relevance to malaria transmission in Pacurita. No mixed malaria cases were recorded in Pacurita in 2010. The prevalent parasite species in Pacurita during 2010 was P. falciparum and malaria cases of a 7 year-old child and a 19 year-old pregnant woman (permanent inhabitant) support the initial statement that malaria parasites may be acquired in this locality, but evidence from the small number of cases (n=17) suggests that people are more likely to acquire parasites in the surrounding sylvatic environment, related to travel associated with some economical activities (logging, placer gold mining, etc) or in urban areas such as Quibdó (Ochoa & Osorio, 2006). Because of the P. vivax cases (n=3) one recommendation would be identification and treatment of asymptomatic persons to try to block or at least reduce local transmission. The fenitrothion ULV indoor house-spraying during early July (2010) may have resulted in the reduction of adult and immature forms and perhaps also affected malaria case numbers. Routine use of long lasting insecticide-treated nets is recommended, especially because house construction represents easy access by vectors, and An. nuneztovari was found active through the entire nighttime. Repellants could be used in forested surroundings and during usual daytime activities (school children, fishermen, etc). We recommend the strengthening of accurate malaria diagnosis and early disease treatment locally, because obstacles such as poverty and poor quality roads impede inhabitants’ access to health services in Quibdó (7 km away). Land use changes and high environmental impact economic activities will continue into the foreseeable future and will surely alter vector biology and ecology (Conn, et al., 2002; Diabate, et al., 2002; Moreno, Rubio-Palis, Páez, Pérez, & Sánchez, 2007; Munga, et al., 2009; Vittor, et al., 2006; Vittor, et al., 2009; Yasuoka & Levins, 2007). It is important to continue studying malaria vectors and malaria epidemiology in this small township, with the overall goal of reducing local malaria incidence and interrupting the movement of parasites from Pacurita to Quibdó.
24 Determinación del papel en la transmisión de malaria de las especies de Anopheles
ACKNOWLEDGEMENTS Authors wish to acknowledge to Humberto Mosquera Jaramillo, José Dolores Palacios, Jatney Palacios, Martha Lucía Quiñones, to the staff of the Laboratorio de Entomología-Facultad de Medicina (Universidad Nacional de Colombia-sede Bogotá), Martha Liliana Ahumada, José Florencio Mosquera and Pacurita inhabitants. Funding sources; Universidad Nacional de Colombia (QuiPu 201010012197), USA NIH AI 2R01AIO54139. REFERENCES Ahmad, O., Boschi-Pinto, C., Lopez, A., Murray, C., Lozano, R., & Inoue, M. (2001). Age standardization of rates; a new WHO standard. GPE Discussion Paper Series: No.31 .
Arevalo, M., Quiñones, M., & Guerra, C. (2012). Malaria in selected non-Amazonian countries of Latin America. Acta Tropica 2012; 121: 303–314 . Belkin, J., Schick, R., Galindo, P., & Aitken, T. (1967). Estudios sobre mosquitos (Diptera: Culicidae). Ia. Un proyecto para un estudio sistemático de los mosquitos de mesoamérica. Ila. Métodos para coleccionar, criar y preservar mosquitos. Contrib Am Entomol Inst 1967; 1: 163-80.
Brasil, P., de Pina Costa, A., Pedro, R., da Silveira Bressan, C., da Silva, S., Tauil, P., et al. (2011). Unexpectedly long incubation period of Plasmodium vivax malaria, in the absence of chemoprophylaxis, in patients diagnosed outside the transmission area in Brazil. Malar J 2011 ;10:122 . Brochero, H., & Quiñones, M. (2008). Retos de la entomología médica para la vigilancia en salud pública en Colombia: reflexión para el caso de malaria. Biomédica 2008;28:18-24 . Brochero, H., Pareja, P., Ortiz, G., & Olano, V. (2006). Sitios de cría y actividad de picadura de especies de Anopheles en el municipio de Cimitarra, Santander, Colombia. Biomédica 2006;26:269-77 . Brochero, H., Rey, G., Buitrago, L., & Olano, V. (2005). Biting activity and breeding sites of Anopheles species in the municipality Villavicencio, Meta, Colombia. J Am Mosq Control Assoc 2005;21(2):182-6 . Chaparro, P. (2012). Mortalidad por paludismo, un vistazo desde el SIVIGILA, Colombia. Inf Quinc Epidemiol Nac 2012;17(2):11-9 .
Conn, J., Wilkerson, R., Segura, M., de Souza, R., Schlichting, C., Wirtz, R., et al. (2002). Emergence of a new neotropical malaria vector facilitated by human migration and changes in land use. Am J Trop Med Hyg 2002; 66(1): 18-22.
Diabate, A., Baldet, T., Chandre, F., Akoobeto, M., Guiguemde, T., Darriet, F., et al. (2002). The role of agricultural use of insecticides in resistance to pyrethroids in Anopheles gambiae s.l. in Burkina Faso. Am J Trop Med Hyg 2002; 67(6): 617-22 .
Capítulo 1 25
Djouaka, R., Bakare, A., Bankole, H., Doannio, J., Coulibaly, O., Kossou, H., et al. (2007). Does the spillage of petroleum products in Anopheles breeding sites have an impact on the pyrethroid resistance? Malar J 2007; 6: 159 . Estrada, D., Quiñones, M., Sierra, D., Calle, D., Ruiz, F., Erazo, H., et al. (2003). Utilidad de la morfología de los huevos como método indirecto para identificar Anopheles benarrochi Gabaldón,Cova García & López, Anopheles oswaldoi (Peryassu) y Anopheles rangeli Gabaldón, Cova García & López, (Diptera:Culicidae) en Putumayo, Colombia. Biomédica 2003;23:388-95. Faran, M. (1980). A revisión of the Albimanus section of the subgenus Nyssorhynchus. Contrib Am Entomol Inst. 1980; 15:1-215. Faran, M., & Linthicum, K. (1981). A handbook of the Amazonian species of Anopheles (Nyssorhynchus) (Diptera: Culicidae). Mosq Syst. 1981; 13:1-81. Fleming, G. (1986). Biología y ecología de los vectores de la malaria en las Américas. Washington D.C.: Organización Panamericana de la Salud. p.13-6. Girod, R., Gaborit, P., Carinci, R., Issaly, J., & Fouque, F. (2008). Anopheles darlingi bionomics and transmission of Plasmodium falciparum, Plasmodium vivax and Plasmodium malariae in Amerindian villages of the Upper-Maroni Amazonian forest, French Guiana. Mem. Inst. Oswaldo Cruz 103; 7: 702-710 . González, R., & Carrejo, N. (2009). Introducción al estudio taxonómico de Anopheles de Colombia: claves y notas de distribución. 2da edición. Programa editorial Univalle. 260pp. Herrera, S., Suárez, M., Sánchez, G., Quiñones, M., & Herrera, M. (1987). Uso de la técnica inmunoradiométrica (IRMA) en Anopheles de Colombia para la identificación de esporozoítos de Plasmodium. Colombia Médica. 1987;18:57-60. Hijmans, R., Cameron, S., Parra, J., Jones, P., & Jarvis, A. (2005). Very high resolution interpolated climate surfaces for global land areas. International Journal of Climatology 25: 1965-1978. Jiménez, P., Conn, J., Wirtz, R., & Brochero, H. (2012). Anopheles (Díptera: Culicidae) vectores de malaria en el municipio de Puerto Carreño, Vichada, Colombia. Biomédica 2012;32(Supl.):13-21. Kaufman, M., Wanja, E., Maknojia, S., Bayoh, M., Vulule, J., & Walker, E. (2006). Importance of algal biomass to growth and development of Anopheles gambiae larvae. J Med Entomol. 2006 Jul;43(4):669-76. Koenraadt, C., Paaijmans, K., Schneider, P., Githeko, A., & Takken, W. (2006). Low larval vector survival explains unstable malaria in the western Kenya highlands. Trop Med Int Health. 2006 Aug;11(8):1195-205. Macdonald G. (1957) The epidemiology and control of malaria. Oxford: Oxford University Press.
26 Determinación del papel en la transmisión de malaria de las especies de Anopheles
McKeon, S., Schlichting, C., Povoa, M., & Conn, J. (2013). Ecological suitability and spatial distribution of five anopheles species in amazonian Brazil. Am J Trop Med Hyg 2013; 88(6): 1079-86 .
Mirabello, L., & Conn, J. (2008). Population analysis using the nuclear white gene detects Pliocene/Pleistocene lineage divergence within Anopheles nuneztovari in South America. Medical and Veterinary Entomology, 22, 109–119. Montoya-Lerma, J., Solarte, Y., Giraldo-Calderón, G., Quiñones, M., Ruiz-López, F., Wilkerson, R., et al. (2011). Malaria vector species in Colombia - A review. Mem Inst Oswaldo Cruz. 2011 Aug;106 Suppl 1:223-38. Moreno, J., Rubio-Palis, Y., Páez, E., Pérez, E., & Sánchez, V. (2007). Abundance, biting behaviour and parous rate of anopheline mosquito species in relation to malaria incidence in gold-mining areas of southern Venezuela. Med Vet Entomol. 2007 Dec;21(4):339-49. Moreno, M., Bickersmith, S., Harlow, W., Hildebrandt, J., McKeon, S., Silva-do-Nascimento, T., et al. (2013). Phylogeography of the neotropical Anopheles triannulatus complex (Diptera: Culicidae) supports deep structure and complex patterns. Parasit Vectors. 2013 Feb 22;6:47. Munga, S., Yakob, L., Mushinzimana, E., Zhou, G., Ouna, T., Minakawa, N., et al. (2009). Land use and land cover changes and spatiotemporal dynamics of anopheline larval habitats during a four-year period in a highland community of Africa. Am J Trop Med Hyg. 2009 Dec;81(6):1079-84. Murillo, C., Astaiza, R., & Fajardo, P. (1988). Biologia de Anopheles (Kerteszia) neivai H., D. & K., 1913 (Diptera: Culicidae) en la costa Pacífica de Colombia. I. Fluctuación de la población larval y características de sus criaderos. Rev. Saúde Pública vol.22 no.2. Murillo, C., Astaiza, R., & Fajardo, P. (1988). Biologia de Anopheles (Kerteszia) neivai H., D. & K., 1913 (Diptera: Culicidae) en la Costa Pacífica de Colombia. III. Medidas de luminosidad y el comportamiento de picadura. Rev. Saúde Pública vol.22 no.2. Murillo, C., Jaramillo, C., Quintero, J., & Suarez, M. (1989). Biología de Anopheles (Kerteszia) neivai H., D. & K., 1913 (Diptera: Culicidae) en la Costa Pacifica de Colombia. IV – Estructura etárea y transmisión de malaria. Rev. Saúde Pública vol.23 no.5. Ochoa, J., & Osorio, L. (2006). Epidemiología de malaria urbana en Quibdó, Chocó. Biomédica 2006;26:278-85. Oksanen, J., Guillaume, F., Kindt, R., Legendre, P., Minchin, P., O'Hara, R., et al. (2011). vegan: Community Ecology Package. R package. Olano, V., Brochero, H., Sáenz, R., Quiñones, M., & Molina, J. (2001). Mapas preliminares de la distribución de especies de Anopheles vectores de malaria en Colombia. Biomédica 2001;21:402-8. Pino, N., & Valois, H. (2004 ). Ethnobotany of Four Black communities of the Municipality of Quibdó -Chocó, Colombia. Lyonia, 7: 59-68.
Capítulo 1 27
POT - Quibdó. (2012). Plan de Ordenamiento Territorial - Municipio de Quibdó. Rubio-Palis, Y. (2000). Anopheles (Nyssorhynchus) de Venezuela: taxonomía, bionomía, ecología e importancia médica. Escuela de Malariologia y Saneamiento Ambiental. Maracay, Venezuela. 2000; 120p. Rubio-Palis, Y., & Zimmerman, R. (1997). Ecoregional classification of malaria vectors in the neotropics. J Med Entomol. 1997 Sep;34(5):499-510. Service, M. (1993). Mosquito Ecology, Field sampling methods. Ed. Chapman & Hall. London, U.K. Servicio de Erradicacion de la Malaria. (1957). Plan de Erradicación de la Malaria en Colombia. Volumen I y II. Bogotá: Ministerio de Salud Nacional. Sierra, D., Velez, I., & Linton, Y. (2004). Malaria vector anopheles (Nyssorhynchus) nuneztovari comprises one genetic species in colombia based on homogeneity of nuclear ITS2 rDNA. J Med Entomol. 2004 May;41(3):302-7. Solarte, Y., Hurtado, C., Gonzalez, R., & Alexander, B. (1996). Man-biting activity of Anopheles (Nyssorhynchus) albimanus and An. (Kerteszia) neivai (Diptera: Culicidae) in the Pacific lowlands of Colombia. Mem Inst Oswaldo Cruz. 1996 Mar-Apr;91(2):141-6. Suarez, M., Quiñones, M., Palacios, J., & Carrillo, A. (1990). First record of DDT resistance in Anopheles darlingi. J. Am. Mosq. Control Assoc. 6, 72–74. ter Brak, C. (1986). Canonical Correspondence Analysis: A New Eigenvector Technique for Multivariate Direct Gradient Analysis. Ecology 67: 1167–1179 . Vittor, A., Gilman, R., Tielsch, J., Glass, G., Shields, T., Lozano, W., et al. (2006). The effect of deforestation on the human-biting rate of Anopheles darlingi, the primary vector of Falciparum malaria in the Peruvian Amazon. Am J Trop Med Hyg 2006 Jan;74(1):3-11. Vittor, A., Pan, W., Gilman, R., Tielsch, J., Glass, G., Shields, T., et al. (2009). Linking deforestation to malaria in the Amazon: characterization of the breeding habitat of the principal malaria vector, Anopheles darlingi. Am J Trop Med Hyg. 2009 Jul;81(1):5-12. Warrell, D., & Gilles, H. (2002). Essential Malariology. 4th edition. New York. Oxford University Press. 2002:192. WHO. (1975). Manual on Practical Entomology in Malaria. Part II: Methods and Techniques, Geneva, 191 pp. Wirtz, R. (2009). Sporozoite ELISA directions. Center for Disease Control and Prevention, Atlanta, USA. Wirtz, R., Burkot, T., Andre, R., Rosenberg, R., Collins, W., & Roberts, D. (1985). Identification of Plasmodium vivax sporozoites in mosquitoes using an enzyme-linked immunosorbent assay. Am Jour Trop Med Hyg 1985; 34: 1048-1054p .
28 Determinación del papel en la transmisión de malaria de las especies de Anopheles
Wirtz, R., Burkot, T., Graves, P., & Andre, R. (1987). Field evaluation of enzyme-linked immunosorbent assays for Plasmodium falciparum and Plasmodium vivax sporozoites in mosquitoes (Diptera: Culicidae) from Papua New Guinea. J Med Entomol. 1987;24:433-7.
Yasuoka, J., & Levins, R. (2007). Impact of deforestation and agricultural development on anopheline ecology and malaria epidemiology. Am J Trop Med Hyg 2007; 76(3): 450-60 .
2. Capítulo 2. Bionomía de Anopheles spp. De Puerto Gaitán, Meta Colombia 2009.
2.1 Breeding sites of Anopheles spp. (Diptera:
Culicidae) in the municipality of Puerto Gaitán -
Meta, Colombia
[Paper written under Bulletin of Entomological Research guidelines]
Sebastián Durán1, Luz Stella Buitrago
2, Jan E. Conn
3,4, Helena
Brochero1*
1 Facultad de Agronomía, Universidad Nacional de Colombia, Bogotá DC, Colombia
2 Unidad de Entomología, Secretaría Departamental de Salud del Meta, Villavicencio, Meta,
Colombia 3 Griffin Laboratory, Wadsworth Center, New York State Department of Health, Slingerlands, NY,
12159 USA 4 Department of Biomedical Sciences, School of Public Health, State University of New York,
Albany, NY, 12222 USA *Corresponding author
RUNNING TITLE Mal. vector breeding sites on Puerto Gaitán ABSTRACT Puerto Gaitán (Meta, Colombia), the 4th largest Colombian municipality, is located in the Colombian Orinoquia region, a savannah environment experiencing continuous land use change (Ramírez, 2012). During 2009, one fatal case of malaria was reported in this locality and it was hypothesized that this may have been due to urban transmission (Buitrago, Brochero, McKeon, Lainhart, & Conn, 2013). This work aimed to identify the Anopheles spp. in local (urban and periurban) breeding sites to provide baseline information on the local biology and ecology of immature stages. This study recorded five Anopheles species; An. darlingi was the most abundant, followed by An. braziliensis, An. oswaldoi sl, An.
30 Determinación del papel en la transmisión de malaria de las especies de Anopheles
rangeli and An. albitarsis sl. The immature stages were distributed in 19 of 27 inspected breeding sites and both artificial and natural breeding sites were positive and included fishponds (44,4%, n=12), small streams (7,4%, n=2), and drainage ditches (7,4%, n=2). The remaining positive breeding site types (“Morichera”, river overflow, river margin) accounted for 3,7% each. Negative breeding site types (29,6%, n=8) were small stream (3,7%, n=1), fishponds (14,8%, n=4), flooded pastures (7,4%, n=2) and flooded forest (3,7% ,n=1). Factors such as pisciculture, cyclic flooding and distance of the breeding sites to human dwellings are likely to affect malaria transmission risk. Keywords Anopheles immature breeding-sites biology ecology Colombia Orinoquia INTRODUCTION Puerto Gaitán (149m), in the Orinoquia region, is the fourth largest municipality in Colombia (17424km2). It is located in a savannah environment, which has been transformed by urban growth. Is located on the Manacacías river Watershed (region), which periodically floods some local urban and periurban areas (Cicery, Gualtero, & Cicery, 2005). The average temperature is 26°C, annual rainfall is 2200mm, and there is a monomodal rainfall distribution (rainy season from March to November). Economical activities range from livestock, agriculture, trade, oil exploitation, tourism, to fishing (artisanal). In the 2005 census there were 15475 inhabitants, with 37,7% self reporting as indigenous (DANE, 2005). Although, local government authorities argue that the population might be more above 31139 inhabitants, and native population could represent a bigger portion (43,21%). Factors such as internal armed conflict and increasing oil exploitation activities have resulted in unexpected immigration and local socioeconomic problems commonly associated with such events (Buitrago, Brochero, McKeon, Lainhart, & Conn, 2013). An. darlingi is reported to be the main vector in Meta´s Department (Ahumada M. , 2009; Olano, Brochero, Sáenz, Quiñones, & Molina, 2001; Ahumada, Pareja, Buitrago, & Quiñones, 2013), nevertheless, An. marajoara of the Albitarsis Complex has been hypothesized to be involved in local transmission in Villavicencio (Brochero, Rey, Buitrago, & Olano, 2005), Meta´s capital city. There is evidence of urban malaria transmission, and Plasmodium vivax is the prevalent parasite species (Buitrago, Brochero, McKeon, Lainhart, & Conn, 2013). Human intervention in the environment plays an important role in malaria vector ecology, particularly in the generation of new breeding sites able to be colonized by anophelines (Conn, et al., 2002; Gil, Tada, Katsuragawa, Ribolla, & da Silva, 2007). Such breeding sites could interact with cyclic floods (Ahern, Kovats, Wilkinson, Few, & Matthies, 2005; Osorio S. , 2011) to alter species
Capítulo 2 31
dynamics such as relative abundances, composition, seasonality and malaria transmission (Conn, et al., 2002; Gil, Tada, Katsuragawa, Ribolla, & da Silva, 2007). The study objectives were 1) to identify the Anopheles spp. and their breeding sites in Puerto Gaitán; and 2) provide fundamental data on the biology and the ecology of Anopheles spp. immature stages in this locality. Additionally, this study seeks to provide data to support decision-making related to local control strategies of the immature forms. MATERIALS AND METHODS Study area This study was performed in 2009 (March-May, July-August, October, December), in urban and periurban areas of Puerto Gaitán-Meta, Colombia (04°19′N, 72°05′W).
Figura 2.1-1. Puerto Gaitán (Meta, Colombia) (taken from Wikimedia Commons)
Immature collection and breeding site characterization A standard dipper method was used to collect Anopheles spp. immatures (Service M. , 1993; WHO, 1975) in the breeding sites previously reported by local public health authorities, each site was completely covered taking 20 dives every 5 m. Breeding sites were classified into 21 main categories, as seen on Tabla 2.1-1.
32 Determinación del papel en la transmisión de malaria de las especies de Anopheles
Collections were carried out monthly, and alive collected individuals were transported to the Laboratorio de Genética de Insectos insectary at Universidad Nacional de Colombia (Bogotá DC, Colombia- temperature from 24°C-27°C, relative humidity from 65% -72%) or to the Unidad de Entomología (Laboratorio de Salud Pública, Secretaría Departamental de Salud del Meta, Villavicencio, Meta, Colombia), and were fed with ground dog food to obtain adults from entomological series (Belkin, Schick, Galindo, & Aitken, 1967; WHO, 1975) for taxonomic identification. Adult individuals were coded and individually stored in 1.5ml eppendorf tubes; which were tagged, grouped and maintained in bags with silica gel desiccant in a -20°C freezer. Dead immature forms, exuviae of fourth instar larvae and pupae were stored in individually labeled plastic vials with 70%V/V ethanol.
Categories of the Breeding Sites
1. Lake, lagoon 8. Tree hole 15. Fallen fruit 2. Fishpond 9. Rock hole 16. Stem internode 3. River margin 10. Small stream 17. Water sump 4. Flooded pasture 11. Animal foot-print 18. Swamp 5. Flooded forest. 12. Car tire-print 19. Puddle 6. Drainage ditch 13. Crab hole 20. Artificial reservoir 7. Well, tank 14. Ricefield 21. “Jagüey”
22. Others (p.ej. “Morichera”, River overflow) Tabla 2.1-1. Established breeding site categories for Puerto Gaitán (Meta, Colombia), 2009.
Georeferencing was carried out using a Garmin eTrex® GPS device (WGS84 coordinate system, degrees and minutes with three decimal positions). Whenever possible, variables such as estimated area [width(m) X length(m); then categorized depending upon the whole dataset], sunlight exposure (full sunlight exposure, partial and total shade), presence of some associated vegetation types (emerging, surrounding and/or floating vegetation), water movement (fast, slow and null stream), water turbidity (clear, turbid), presence of organic material (WHO, 1975) and general observations. Taxonomic identification Taxonomic identification was conducted with dichotomous keys and based on characteristics of the immature stages and general adult morphology (Faran M. , 1980; Faran & Linthicum, 1981; González & Carrejo, 2009; Rubio-Palis, 2000). Ecological and statistical analyses The breeding sites localization map was overlaid onto a thematic ecosystem map of the Orinoquia region [IaVH, WMS service; (Romero, Galindo, Otero, & Armenteras, 2004)], and the data generated were added to each breeding site characterization and considered for further analyses. Interactions between Anopheles spp. and their breeding sites were plotted using the functions plotweb
Capítulo 2 33
and visweb found on the R (R Development Core Team, 2011) package bipartite (Dormann et.al. 2009). Correspondence Analysis (CA) was carried out to evaluate the association between Anopheles species and the breeding sites and types of positive breeding sites. Results were interpreted using the different environmental variables and observations taken for this study, i.e., indirect gradient analysis (ter Brak, 1986). CAs were obtained with vegan (Oksanen, et al., 2011) for the R software environment for statistical computing and graphics (R Development Core Team, 2011). RESULTS Immature collections Five species were recorded: An. braziliensis, An. darlingi, An. albitarsis sl., An. oswaldoi sl. and An. rangeli. Individuals that did not develop to the 4th instar or those that were damaged could not been identified to species level (data not shown).
Figura 2.1-2. Seasonality of Anopheles spp. immature individuals in Puerto Gaitán (Meta, Colombia)-
2009. N=178
Breeding site characterization
34 Determinación del papel en la transmisión de malaria de las especies de Anopheles
Two breeding sites were not geo-referenced, a flooded pasture type and a river margin type. Small streams (n=3) were permanent water bodies, sizes from 2000-5000m2, partial shade, with slow water movement and always with circundant vegetation but a variable composition of the other two defined types of vegetation (floating and emerging).
Figura 2.1-3. Anopheles spp. breeding sites on Puerto Gaitán (Meta, Colombia)-2009 (IDEAM, WMS
services)
Fishponds (n=16) were devoted to raising “cachama” (Colossoma macropomum); were permanent (n=10) and temporal (n=6) breeding sites, with sizes between 18m2 and 800m2, ranging from shallow (water level=5cm) to 150cm, with total or partial sunlight exposure, clear or turbid water, always stagnant, and with different combinations of vegetation types. Morichera breeding site type (n=1, natural breeding site) was in a flooded area dominated by the presence of “moriche” palm-trees (Mauritia flexuosa). Its area was about 200m2, it was temporal with full sunlight exposure, clear water, surrounding and emergent vegetation, and with a sandy texture on the bottom. On one sampling occasion it was found polluted with sewage water because it was connected to the rainwater drainage system. River overflow (n=1) was located on the opposite margin of the Manacacías river. The georeference information for this breeding site was taken from previous studies carried out by local health authorities and was not fully sampled during
Capítulo 2 35
2009 due to safety issues. Flooded pasture (n=2) were temporal flooded grassland patches, with a combination of partial shade and full sunlight exposure, clear and turbid water, with a slow current and stagnant water, circundant vegetation, and muddy bottom material. One pasture was reported with human fecal contamination. Flooded forest (n=1), area above 100m2, was temporal, with all three vegetation types. It was completely dry in the December collection. Drainage ditches (n=2), were temporal narrow water strips, with full sunlight exposure, slow water movement, three vegetation types and with sandy and muddy bottom textures. Ecological and statistical analyses CA was carried out to assess Anopheles spp. association with breeding sites (dimensions accounted for a cumulative percentage of variance of 70,6%) (data not shown), after performing clustering (Fig2.1-4) of the breeding sites based on Anopheles spp. distribution. As most of the fishpond sites clustered together, an additional CA was carried out.
Figura 2.1- 4. Breeding site clustering after CA. *temporal breeding site type; DrainD=Drainage ditch,
SmStr=Small stream, FishP=Fishpond, RivOF=Rivero overflow, Mori=”Morichera”, RivMa=River Margin. (Breeding sites with abundances equal to 1 Anopheles spp. individual were not taken in
count, n=17)
36 Determinación del papel en la transmisión de malaria de las especies de Anopheles
For the new CA, each one of the aforementioned breeding sites types (Tabla 2.1-1) was subdivided into permanent and temporal, thus doubling the amount of types of breeding sites. This was done in order to assess the association between Anopheles spp. and types of breeding sites taking in count their persistence thru time as an important factor. CA factor map plotting dimensions accounted for a cumulative percentage of variance of 83.63%.
Figura 2.1- 5. Correspondence Analyses factor map; Anopheles spp. VS breeding sites
types.*temporal breeding site type; DrainD=Drainage ditch, SmStr=Small stream, FishP=Fishpond, RivOF=Rivero overflow, Mori=”Morichera”, RivMa=River Margin (Breeding sites with abundances
equal to 1 individual were not taken in count)
According to ecosystem map [IaVH, 2013 WMS service; (Romero, Galindo, Otero, & Armenteras, 2004)] overlaying breeding sites (BS) were distributed among five ecosystems; Urban zones-infrastructure (3 small stream BS´s, 13 fishpond BS´s, 1 drainage ditch BS), Water-body (1 flooded forest BS), Overflow savannah on aeolian-influenced floodplain (3 fishpond BS´s, 1 drainage ditch BS), Dune savannah on aeolian-influenced floodplain (1 flooded pasture BS, 1 “Morichera” BS); a river overflow BS was found between the transition of Overflow savannah
-1 0 1 2
-1.0
-0.5
0.0
0.5
1.0
1.5
2.0
CA factor map
Dim 1 (57.86%)
Dim
2 (
25
.77
%)
SmStr
FishPFishP*
Mori*
RivOf*
RivMa*DrainD*
An_bra
An_dar
An_alb
An_osw
An_ran
Capítulo 2 37
on aeolian-influenced floodplain ecosystem and Medium (altitude) dense forest on flooding plane of aeolian-influenced floodplain ecosystem.
Figura 2.1- 6. Interaction network between Anopheles spp. and their breeding sites, Puerto Gaitán-Meta (Colombia, 2009) .*temporal breeding site type; DrainD=Drainage ditch, SmStr=Small stream, FishP=Fishpond, RivOF=Rivero overflow, Mori=”Morichera”, RivMa=River Margin. Thickness of the
38 Determinación del papel en la transmisión de malaria de las especies de Anopheles
connecting line represents connected Anopheles spp. abundance to a specific breeding site, breeding site box thickness represents the amount of all Anopheles spp. found there, and species box
thickness represents a species total abundance (Breeding sites with abundances equal to 1 individual were not taken in count, n=17)
DISCUSSION Observed presence and abundance of An. darlingi and the presence of An. albitarsis sl support the ecoregion sabana-subregion llanos classification of Puerto Gaitán (Rubio-Palis & Zimmerman, 1997). As observed in the clustering (Figura
2.1- 4), fishponds seem to provide a very suitable environment (water quality, sunlight conditions, temperature, pH) and may provide certain resources (food, shelter) for An. darlingi immature stages. Although this was not fully evaluated, the CA interpretation (Figura 2.1- 5) is suggestive, and should be considered in studies to evaluate environmental and ecological factors using a finer resolution than the present study. This study is important because An. darlingi has not usually been reported occupying this type of breeding sites (Sinka, et al., 2010) and only few examples of this exist (Montoya-Lerma, et al., 2011; Vittor, et al., 2009). As these breeding sites were located in highly anthropic environments, this species seems to demonstrate adaptation to local land-use changes (Montoya-Lerma, et al., 2011). An. darlingi high abundances in these breeding sites were associated with the rainy season (Rubio-Palis, Menare, Quinto, Magris, & Amarista, 2005), although there were not enough sampled months in the dry season during this study (March and December) to fully evaluate this. In addition, An. darlingi abundance drops in August for no apparent reason. Cyclic flooding represents an additional risk because it provides new breeding sites and increases the sizes of the existing ones. This could be assessed more completely by additional breeding site analysis in Puerto Gaitán to fully place this assertion. Remote sensing has also been a useful tool for detecting potential new breeding sites (Mushinzimana, et al., 2006) and could also serve to evaluate future land use changes in this Orinoquia locality. Distance of An. darlingi positive breeding sites to human habitation increases risk (Barros, Honorio, & Arruda, 2010) and in our study neighborhoods with high malaria incidence (local malaria hotspots) such as Trampolín and Manacacías accounted for most of the fishponds. Although, as An. darlingi flight range is estimated at 2-7 km(Charlwood & Alecrim, 1989) these fishponds may also be a source of this human-biting species for the whole urban area, and represent an important factor in local malaria transmission dynamics and epidemiology (Buitrago, Brochero, McKeon, Lainhart, & Conn, 2013). Entomological control strategies focusing on immature stages, such as biolarvicide application (Fillinger & Lindsay, 2011; Fillinger, Sonye, Killeen, Knols, & Becker, 2004) and weeding should considered as a local strategy for small and medium sized artificial sites like fishponds (Brochero, Rey, Buitrago, & Olano, 2005). We also suggest carrying out a study to project the construction of engineering works to mitigate cyclic flooding occurrence nearby human dwellings.
Capítulo 2 39
ACKNOWLEDGEMENTS Secretaría Seccional de Salud del Meta (Colombia), Secretaria de Salud de Puerto Gaitán - Meta (Colombia), Humberto Mosquera, Jimena Molano, Luz Stella Buitrago and Puerto Gaitán community. Funding sources; Universidad Nacional de Colombia (QuiPu 201010012197), USA NIH AI 2R01AIO54139. REFERENCES
Ahern M., Kovats R., Wilkinson P., Few R., Matthies F. 2005. Global Health
Impacts of Floods: Epidemiologic Evidence. Epidemiol Rev 27(1): 36-46.
Ahumada M. 2009. Determinación del papel como vector de malaria de las
especies de Anopheles presentes en el departamento del Meta, Colombia.
Universidad Nacional de Colombia, Facultad de Medicina, Infecciones y Salud en
el Trópico.
Ahumada M., Pareja P., Buitrago L.E., Quiñones M.L. 2013. Comportamiento de
picadura de Anopheles darlingi Root, 1926 (Diptera: Culicidae) y su asociación
con la transmisión de malaria en Villavicencio (Meta, Colombia). Biomédica 33(2)
.
Belkin J., Schick R., Galindo P., Aitken T. 1967. Estudios sobre mosquitos
(Diptera: Culicidae). Ia. Un proyecto para un estudio sistemático de los mosquitos
de mesoamérica. Ila. Métodos para coleccionar, criar y preservar mosquitos.
Contrib Am Entomol Inst 1: 163-80.
Brochero H., Rey G., Buitrago L., Olano V. 2005. Biting activity and breeding sites
of Anopheles species in the municipality Villavicencio, Meta, Colombia. J Am
Mosq Control Assoc 21(2):182-6 .
Buitrago L., Escobar A., Peña N., Conn J.E., Brochero H. 2010. First record of
urban malaria in Puerto Gaitán, Meta. Colombia. 76th Annual Meeting of the
American Mosquito Control Association and 20th Latin American Symposium .
Charlwood J., Alecrim W. 1989. Capture-recapture studies with the South
American malaria vector Anopheles darlingi, Root. Ann Trop Med Parasitol
83(6):569-76 .
Cicery E. 2005. Monografía del municipio de Puerto Gaitán; visión geohistórica y
cultural. 105pp.
40 Determinación del papel en la transmisión de malaria de las especies de Anopheles
Conn J.E., Wilkerson R., Segura M., de Souza R., Schlichting C., Wirtz R., et al.
2002. Emergence of a new neotropical malaria vector facilitated by human
migration and changes in land use. Am J Trop Med Hyg 66(1): 18-22.
Faran M. 1980 A revisión of the Albimanus section of the subgenus
Nyssorhynchus. Contrib Am Entomol Inst. 15:1-215. .
Faran M., Linthicum K. 1981. A handbook of the Amazonian species of Anopheles
(Nyssorhynchus) (Diptera: Culicidae). Mosq Syst. 13:1-81.
Fillinger U., Lindsay S. 2011. Larval source management for malaria control in
Africa: myths and reality. Malar J. 13;10:353.
Fillinger U., Sonye G., Killeen G., Knols B., Becker N. 2004) The practical
importance of permanent and semipermanent habitats for controlling aquatic
stages of Anopheles gambiae sensu lato mosquitoes: operational observations
from a rural town in western Kenya. Trop Med Int Health. 9(12):1274-89.
Gil L., Tada M., Katsuragawa T., Ribolla P., da Silva L. 2007. Urban and suburban
malaria in Rondônia (Brazilian Western Amazon) II. Perennial transmissions with
high anopheline densities are associated with human environmental changes.
Mem Inst Oswaldo Cruz. 102(3):271-6.
González R., Carrejo N. 2009. Introducción al estudio taxonómico de Anopheles
de Colombia: claves y notas de distribución. 2da edición. Programa editorial
Univalle. 260pp.
Montoya-Lerma J., Solarte Y., Giraldo-Calderón G., Quiñones M., Ruiz-López F.,
Wilkerson R., et al. 2011. Malaria vector species in Colombia - A review. Mem Inst
Oswaldo Cruz. 106 Suppl 1:223-38.
Mushinzimana E., Munga S., Minakawa N., Li L., Feng C., Bian L., et al. 2006.
Landscape determinants and remote sensing of anopheline mosquito larval
habitats in the western Kenya highlands. Malar J 5:13.
Oksanen J., Guillaume F., Kindt R., Legendre P., Minchin P., O'Hara R., et al.
2011. vegan: Community Ecology Package. R package.
Olano V., Brochero H., Sáenz R., Quiñones M., Molina J. 2001. Mapas
preliminares de la distribución de especies de Anopheles vectores de malaria en
Colombia. Biomédica 21:402-8.
Osorio, S. 2011. Lo invisible de las emergencias. Biomédica 31:1.
Capítulo 2 41
Romero M., Galindo G., Otero J., Armenteras D. 2004. Ecosistemas de la cuenca
del Orinoco colombiano. Instituto de Investigación de Recursos Biológicos
Alexander von Humboldt. Bogotá, Colombia. 189 p.
Rubio-Palis Y. 2000. Anopheles (Nyssorhynchus) de Venezuela: taxonomía,
bionomía, ecología e importancia médica. Escuela de Malariologia y Saneamiento
Ambiental. Maracay, Venezuela. 2000; 120p.
Rubio-Palis, Y., Menare C., Quinto A., Magris M., Amarista M. 2005.
Caracterización de criaderos de anofelinos (Diptera: Culicidae) vectores de
malaria del Alto Orinoco, Amazonas, Venezuela. Entomotropica 20: 29-38.
Service M. 1993. Mosquito Ecology, Field sampling methods. Ed. Chapman &
Hall. London, U.K.
Sinka M., Rubio-Palis Y., Manguin S., Patil A., Temperley W., Gething P., et al.
2010. The dominant Anopheles vectors of human malaria in the Americas:
occurrence data, distribution maps and bionomic précis. Parasit Vectors. 3:72.
ter Brak C. 1986. Canonical Correspondence Analysis: A New Eigenvector
Technique for Multivariate Direct Gradient Analysis. Ecology 67: 1167–1179 .
WHO. 1975. Manual on Practical Entomology in Malaria. Part II: Methods and Techniques. Geneva, 191 pp.
42 Determinación del papel en la transmisión de malaria de las especies de Anopheles
2.1 Urban malaria vectors (Anopheles spp.,
Diptera: Culicidae) in Puerto Gaitán municipality-
Meta, Colombia
[Paper written according to guidelines for Medical and Veterinary Entomology]
Sebastián Durán1, Luz Stella Buitrago
2, Jan E. Conn
3,4, Helena
Brochero1*
1 Facultad de Agronomía, Universidad Nacional de Colombia, Bogotá DC, Colombia
2 Unidad de Entomología, Secretaría Departamental de Salud del Meta, Villavicencio, Meta,
Colombia 3 Griffin Laboratory, Wadsworth Center, New York State Department of Health, Slingerlands, NY,
12159, USA 4 Department of Biomedical Sciences, School of Public Health, State University of New York,
Albany, NY, 12222, USA
*Corresponding author ABSTRACT Previous data demonstrate urban malaria transmission in Puerto Gaitán (Meta, Colombia), a large municipality located in the Orinoquia region. This 9 month-long study, carried out on 2009, used human landing catch (HLC, between 18H and 06H) to obtain anopheline specimens. An. darlingi is considered to be the main malaria vector in Meta Department, and during this study it was the most prevalent species (n=3116) and exhibited biting activity at dusk and dawn, with three peak biting times indoor (21-22h, 23-24h and 2-3h); and two outdoor (21-22h and 2-3h). An. braziliensis (n=412) bit throughout the night, both indoor and outdoor, and was collected from the onset of the rainy season to the end of the sampling period (May-Dec). An. albitarsis s.l. was collected only during the rainy season (Jul-Dec), its biting activity indoor peaked at dusk and from 02 to 03h; whereas its activity outdoor was high at dusk, dawn and showed peaks from 00 to 01h and from 02 to 03h. Other species collected were An. oswaldoi s.l. (n=2), An. nuneztovari (n=4), An argyritarsis (n=3) and An. peryassui (n=4). Only one specimen, An. albitarsis F of the Albitarsis Complex, identified as such with the COI barcode, was found infected with P. falciparum. Interestingly, the infected An. albitarsis F was collected in a neighborhood with high malaria incidence. Despite being the most abundant species, An. darlingi was not infected with any human malaria parasite. It is recommended that the local residents wear repellent and use LITN´s to reduce human-vector contact.
Capítulo 2 43
Keywords Anopheles malaria biology vector Colombia Orinoquia INTRODUCTION Puerto Gaitán (Meta Department), the fourth largest municipality (17424km2) in Colombia, is located in the Orinoquia region. With an average altitude of 149 m, it is mostly savannah, transformed by urban growth and economical activities such as livestock, trade, fishing, logging, African oil palm, corn, soy and oil exploitation (Cicery, Gualtero, & Cicery, 2005). It is located on the Manacacias watershed, a river that periodically floods some local urban and periurban areas (Cicery, Gualtero, & Cicery, 2005). It exhibits an average temperature of 26ºC, an annual rainfall of 2200mm, and a monomodal rainfall distribution (rainy season from March to November). Recently Puerto Gaitán has been experiencing rapid urban growth and increased population because of a newly developed oil industry. 25 Anopheles species are reported for the Meta Department (Ahumada M. , 2009), among them the main Colombian Orinoquia vector, An. darlingi (Servicio de Erradicacion de la Malaria, 1957; Jiménez, Conn, Wirtz, & Brochero, 2012). This species is also the main malaria vector in the Meta Department (Ahumada M. , 2009; Ahumada, Pareja, Buitrago, & Quiñones, 2013; Olano, Brochero, Sáenz, Quiñones, & Molina, 2001), a highly antropophilic species with endophagic and exophagic behavior (Rubio-Palis, 2000; Montoya-Lerma, et al., 2011). It has been found in forest environments and near jungles, but it also has been found in semiurban environments such as the periurban area of Quibdó (Chocó, Colombia), a locality with urban malaria transmission (Montoya-Lerma, et al., 2011; Ochoa & Osorio, 2006). Another species, An. marajoara s.s., was reported infected with P. falciparum in Puerto Carreño (Vichada, Colombia), also in the Orinoquia region, where it may be involved in malaria transmission (Jiménez, Conn, Wirtz, & Brochero, 2012). Additionally, Puerto Gaitán has been characterized as a savannah-sub region in the llanos ecoregion (Rubio-Palis & Zimmerman, 1997). Since 2005, there is evidence of urban malaria transmission in this municipality (Buitrago, Brochero, McKeon, Lainhart, & Conn, 2013). Together, unplanned human migration and urbanization, land use changes, forced displacement caused by nearby armed conflict (Buitrago, Brochero, McKeon, Lainhart, & Conn, 2013) and location adjacent to the Departments of Vichada and Casanare, both with high malaria incidence (SIVIGILA, 2009), and are likely shape local malaria transmission dynamics (Buitrago, Brochero, McKeon, Lainhart, & Conn, 2013), and could alter Anopheles spp. biology and/or ecology. This study aimed to 1) identify the human biting species of the genus Anopheles in the municipality of Puerto Gaitán; and 2) assess Anopheles spp. biological aspects that could account for their importance as local vectors.
44 Determinación del papel en la transmisión de malaria de las especies de Anopheles
MATERIALS AND METHODS Study area This study was performed in Puerto Gaitán-Meta, Colombia (04°19′N, 72°05′W), during 2009 (March-May, July-December). Sampling was conducted in houses in 2 neighborhoods identified as malaria hotspots by local health authorities personnel: Paraíso Natural, Trampolín and also in Centro.
Figura 2.2-1. Puerto Gaitán (Meta, Colombia) (Wikimedia Commons)
Mosquito collections Collections in Trampolín, Paraíso Natural and Centro were conducted for 2 consecutive nights (18H to 06H) per sampled month in Puerto Gaitán, during the new moon lunar phase or close to it (Silver & Service, 2008). Mosquitoes were collected by human landing catch (HLC) and sampling hours were divided into 50 minutes for collection and 10 minutes for notes, resting and labeling mosquito collection containers. To avoid bait bias, HLC collectors rotated each hour between indoor (main room, halls or living/dining room) and outdoor (within 10 m of the house) (WHO, 1975). Temperature (ºC) and relative humidity (%) were measured hourly. Human biting rate (per hour and per night) was calculated after taxonomic identification, and was defined as the amount of bites per person per night (Jiménez, Conn, Wirtz, & Brochero, 2012). Taxonomic identification
Capítulo 2 45
Taxonomic identification of the entomological material was carried out using dichotomous keys (Faran M. , 1980; Faran & Linthicum, 1981; González & Carrejo, 2009; Rubio-Palis, 2000). To confirm taxonomic identification, isofamilies were obtained from collected females. An isofamily is defined as a set of eggs, 4th instar larval molt, pupae molt and adult forms obtained from a single egg. To obtain isofamilies, Anopheles spp. females were taken alive to the Laboratorio de Genética de Insectos´ rearing room at Universidad Nacional de Colombia (Bogotá DC, Colombia) and blood-fed on Mus musculus. Blood-fed and unfed wild-females were subjected to forced oviposition wherein each female was anesthetized using Ethyl-acetate and one wing and hind leg were removed to induce oviposition. The individual was then set on the water surface in a small cup half filled with tap water to lay eggs (Estrada, et al., 2003). Larvae were fed with ground dog food, and molts of fourth instar larvae and pupae were stored in plastic vials with 70%V/V ethanol, and adult individuals were kept in plastic 1.5ml eppendorf tubes at -20ºC. Plasmodium spp. natural infection Individuals were tested by ELISA (Enzyme-Linked ImmunoSorbent Assay) for circumsporozoite protein of P. falciparum, P. vivax-VK210 and P. vivax-VK247 (Wirtz R. , Burkot, Andre, Rosenberg, Collins, & Roberts, 1985; Wirtz R. , Burkot, Graves, & Andre, 1987; Wirtz R. , 2009); using the kit (antibodies and positive controls) provided by the Center for Disease Control (CDC, Atlanta, USA). Individuals (thorax and head) were pooled (same species individuals, same time, date and site of collection) for the first round of ELISA, and the cut-off value (absorbance above which a test is considered positive), for each plate, was defined as twice the mean absorbance of the negative controls (Wirtz R. , Burkot, Graves, & Andre, 1987). To confirm infection, a second round of ELISA was carried out using the remaining lysate of pools that were initially positive. Infection was additionally confirmed via polymerase chain reaction carried using species-specific primers (Singh, Bobogare, Cox-Singh, Snounou, Abdullah, & Rahman, 1999). PCR and product visualization (electrophoresis on 2% agarose gel with ethidium bromide stain) were performed with the aid of Instituto Nacional de Salud´s entomology laboratory staff. Taxonomic identification confirmation via molecular tools Confirmation of taxonomic identification of individuals from positive ELISA pools was carried out via sequencing the barcode region of COI mtDNA and assessing these sequences using BLAST (Basic Local Alignment Search Tool, http://blast.ncbi.nlm.nih.gov/Blast.cgi). Genomic DNA was extracted from individual abdomens using QIAGEN® DNeasy Blood & Tissue kit. PCR was carried out using the using the LCO1490 and HCO2198 primers (Folmer, Black, Hoeh, Lutz, & Vrijenhoek, 1994), following the next conditions (95°C for 5:00 min. 35 cycles of; 95°C for 0:30 sec, 48°C for 0:30 sec, 72°C for 0:45 sec). Sequencing
46 Determinación del papel en la transmisión de malaria de las especies de Anopheles
of the forward band was carried out by The Applied Genomics Technology Core (Wadsworth Center, USA). Sequences were edited and trimmed using Sequencher 3.0 (Gene Codes Corps, USA). Entomological data analyses HBR for each species was calculated as the number of female Anopheles spp. bites per person per night (Girod, Gaborit, Carinci, Issaly, & Fouque, 2008). Biting activity was visualized for each hour (Jiménez, Conn, Wirtz, & Brochero, 2012). CSP index was calculated as the proportion of mosquitoes positive for circumsporozoite protein of any of the assayed parasite species (Girod, Gaborit, Carinci, Issaly, & Fouque, 2008). EIR (Entomological Inoculation Rate) was calculated as the amount of infective bites that may be received by a person in a year, EIR=(bites/person/night)*365nights*CSP (MacDonald, 1957). Annual parasite index (API) was calculated for P. falciparum and P. vivax as follows API = (confirmed cases during 1 year/population under surveillance) x 1000. Ethics HLC collection protocol (#02-028a) was approved by the Institutional Review Board (IRB) of the New York State Department of Health (NYSDOH) and Universidad Nacional de Colombia; collectors signed an informed consent form. Anopheles spp female blood feeding with Mus musculus was undertaken following the vertebrate handling protocols (Facultad de Medicina Veterinaria y Zootecnia, Universidad Nacional de Colombia), National Institute of Health (Assurance #A5791-01) and the New York State Department of Health IACUC protocol #11-420. RESULTS Mosquito collection and taxonomic identification 412 hours (206H outdoor, 206H indoor) of HLC were carried out and a total of 3732 Anopheles spp. females were identified as An. darlingi (n=3116), An. braziliensis (n=412), An. albitarsis s.l (n=106), An. oswaldoi s.l (n=2), An. nuneztovari (n=4), An argyritarsis (n=3) and An. peryassui (n=4).
Capítulo 2 47
Figura 2.2- 2. Anopheles spp. HLC sampling points on Puerto Gaitán (Meta, Colombia)-2009 (IDEAM,
WMS services), see Tabla 2.2-1. for additional information.
HLC nighttime collections were distributed among 2009 (Puerto Gaitán) as follows;
Neighborhood Abbreviation Sampled periods Coordenadas
Centro CNA March (1 incomplete night, 18-
24H)* 04° 18.715'N,
72° 04.680'O
Trampolín VT March (1 incomplete night, 18-
22H)* 04° 18.459'N,
72° 04.852'O
Trampolín CDM
March (1 incomplete night, 18-22H)*
April (2 nights, 18-06H) May (2 nights, 18-06H)
04° 18.436'N,
72° 04.967'O
Paraíso Natural OVL
July (2 nights, 18-06H) August (2 nights, 18-06H)
September (2 nights, 18-06H) October (2 nights, 18-06H)
November (2 nights, 18-06H) December (2 nights, 18-06H)
04° 19.293'N,
72° 04.840'O
Tabla 2.2- 1. Anopheles spp. human landing catches on Puerto Gaitán-Meta (Colombia, 2009).*Not taken in count for final analyses and index calculations
Low mosquito densities on March´s (2009) nights caused early (22H, 24H) HLC suspensions (Table 2.2-1). An. darlingi mean HBR was 170.0, mean HBR of 27.5 for An. braziliensis and 6.1 for An. albitarsis sl.
48 Determinación del papel en la transmisión de malaria de las especies de Anopheles
Figura 2.2- 3. A-An. darlingi,B- An. albitarsis sl and C- An. braziliensis, hourly biting activity on Puerto
Gaitán – Meta (Colombia, 2009). *March captures were not taken in count for final analyses
Capítulo 2 49
Figura 2.2- 4. An. darlingi, An. braziliensis and An. albitarsis sl monthly nighttime biting activity on Puerto Gaitán – Meta (Colombia, 2009). A. Indoor, B. Outdoor. *March captures were not taken in
count for final analyses
Plasmodium spp. natural infection A pool with 2 individuals originally identified as An. braziliensis (outdoor; 23-24H; September 16, 2009; Paraíso Natural -OVL-) was positive for P. falciparum for both ELISA rounds. After DNA extraction from individual abdomens using QIAGEN® DNeasy Blood & Tissue kit, both extracts were subjected for PCR to amplify the barcode region from COI mtDNA (Folmer, Black, Hoeh, Lutz, & Vrijenhoek, 1994) to verify the initial mosquito identification. COI sequences were assessed using BLAST (Altschul, Gish, Miller, Myers, & Lipman, 1990) and BOLD (Ratnasingham & Hebert, 2007) search tools. We found that one of the individuals initially identified as An. braziliensis was a member of the Albitarsis complex of Anopheles, with a high identity with An. albitarsis F sequences. A BLAST query of the 707bp sequence resulted in 99% identity with An. albitarsis F; a BOLD query
50 Determinación del papel en la transmisión de malaria de las especies de Anopheles
resulted in 99.85% identity with An. albitarsis F from Cojedes (Venezuela), GenBank Accession JQ615033 (Ruiz, et al., 2012). To determine which species (An. albitarsis F or An. braziliensis) was infected with P. falciparum, PCR using specific primers for this parasite species (rFAL1 and rFAL2) was carried out with the expectation of a positive reaction (Singh, Bobogare, Cox-Singh, Snounou, Abdullah, & Rahman, 1999). An. albitarsis F was found infected with P. falciparum (Figure 2.2-5), thus its CSP was 0.943% (1/106) and its EIR was 21.13 (EIR=6.14*365*0.00943). The infected individual was caught in the Paraíso natural neighborhood (OVL), at 23-24 h outdoor September 16th (2009).
Figura 2.2- 5. PCR (rFAL1-rFAL2) gel electrophoresis; 1)100 bp DNA ladder; 2) Negative PCR control; 3) Positive PCR control (P. falciparum 3D7 strain); 4) An. braziliensis; 5) An. albitarsis F; 6) 100 bp
DNA ladder.
Entomological data analyses Because HLC was carried out in the urban area, the 127 urban malaria cases reported for 2009 (Buitrago, Brochero, McKeon, Lainhart, & Conn, 2013) were considered for the current analysis. 99 of these cases were P. vivax and 28 were P. falciparum. Annual Parasite Index (API) of 3.966 for P. falciparum and 14.023 for P. vivax in the urban area were calculated based on the urban population of 7060 inhabitants in the 2005 national census (DANE, 2010). Most urban P. vivax cases were registered during the 2009 dry season, whereas P. falciparum cases seemed to occur during the rainy season. DISCUSSION The highest HBR for An. darlingi was near the end of the rainy season. An increase in crepuscular biting activity throughout the night was observed but it is not as marked as the one observed at Villavicencio-Meta (Brochero, Rey, Buitrago, & Olano, 2005; Ahumada, Pareja, Buitrago, & Quiñones, 2013). In other
Capítulo 2 51
Orinoquia region localities such as Puerto Carreño-Vichada An. darlingi was found infected by P. vivax-VK210 and showed an activity peak outdoor at 21-22 h (Puerto Gaitán, Meta) and an activity peak at 5-6 h; indoor activity peaked at 21-22 h and 4-5 h (Jiménez, Conn, Wirtz, & Brochero, 2012). These differences in peak biting times underscore the variability in this behavior, perhaps linked to the availability of humans for bloodmeals. For An. albitarsis s.l, the highest HBR was recorded near the end of the rainy season. Biting activities in other Orinoquia regions for this species present some variation (Fig. 2-2-3 B), with the same high activity at dusk in Puerto Carreño during the same year (Jiménez, Conn, Wirtz, & Brochero, 2012). Other activity peaks were shared with Villavicencio (Ahumada M. , 2009). Other species collected in Puerto Gaitán have been reported previously for Meta, for example, An. braziliensis, An. oswaldoi s.l. (n=2), An argyritarsis (n=3) and An. peryassui (n=4). Although elsewhere in Colombia, An. nuneztovari is a vector, in Meta Department in this report, it has a very limited presence (n=4) (Olano, Brochero, Sáenz, Quiñones, & Molina, 2001; Gutiérrez, y otros, 2009). Seasonal variation of HBR could not been fully assessed due to under-sampling of the dry season, with only two months (March being incompletely sampled, December) sampled for this season, which normally goes from December to March. Although An. darlingi and An. albitarsis HBRs were higher on the rainy season, these abundances were not correlated with malaria case reporting throughout 2009. API values for P. falciparum and P. vivax might actually be lower than reported here due to an underestimation of Puerto Gaitán´s population, likely larger in 2009 than reported in 2005. The neighborhood of Paraíso Natural, where the single P. falciparum infected An. albitarsis F individual was caught, is one of the highest P. falciparum incidence neighborhoods, suggesting that this species could be an important local urban vector. The An. albitarsis F EIR could be an overestimation because of incomplete sampling throughout the dry season, when it is expected to be less abundant. Additionally, the lack of sampling during January and February, when most P. vivax cases were reported, could explain lack of infected Anopheles spp. individuals detected. It is important to evaluate An. albitarsis F as vector because this is the first report of its natural infection in the Orinoquia region since it was first recorded in Puerto Carreño, Vichada (Brochero, Li, & Wilkerson, 2007). Assuming the trend of rapid immigration continues in Puerto Gaitán, this evidence of urban malaria transmission suggests that inhabitants should focus on personal protection, such as repellents and long lasting insecticide treated nets, to reduce human-vector contact (WHO, 2013). ACKNOWLEDGEMENTS Secretaría Seccional de Salud del Meta (Colombia). Secretaria de Salud de Puerto Gaitán, Meta (Colombia). Labmates; Pilar Jiménez, Humberto Mosquera, Jimena Molano, Diana Ortiz and Liliana García. Martha Ahumada, Martha Quiñones,
52 Determinación del papel en la transmisión de malaria de las especies de Anopheles
Elizabeth Ruiz and the Puerto Gaitán community. Funding sources; Universidad Nacional de Colombia (QuiPu 201010012197), USA NIH AI 2R01AIO54139. REFERENCES
Ahumada, M. (2009). Determinación del papel como vector de malaria de las
especies de Anopheles presentes en el departamento del Meta, Colombia.
Universidad Nacional de Colombia, Facultad de Medicina, Infecciones y Salud en el
Trópico. 73.
Ahumada, M., Pareja, P., Buitrago, L., & Quiñones, M. (2013). Comportamiento de
picadura de Anopheles darlingi Root, 1926 (Diptera: Culicidae) y su asociación con la
transmisión de malaria en Villavicencio (Meta, Colombia). Biomédica 2013; 33(2) .
Altschul, S., Gish, W., Miller, W., Myers, E., & Lipman, D. (1990). Basic local
alignment search tool. J. Mol. Biol. 215:403-410.
Brasil, P., de Pina Costa, A., Pedro, R., da Silveira Bressan, C., da Silva, S., Tauil, P.,
et al. (2011). Unexpectedly long incubation period of Plasmodium vivax malaria, in the
absence of chemoprophylaxis, in patients diagnosed outside the transmission area in
Brazil. Malar J 2011 ;10:122 .
Brochero, H., Li, C., & Wilkerson, R. (2007). A newly recognized species in the
Anopheles (Nyssorhynchus) albitarsis complex (Diptera: Culicidae) from Puerto
Carreño, Colombia. Am J Trop Med Hyg 2007;76(6):1113-7 .
Brochero, H., Rey, G., Buitrago, L., & Olano, V. (2005). Biting activity and breeding
sites of Anopheles species in the municipality Villavicencio, Meta, Colombia. J Am
Mosq Control Assoc 2005;21(2):182-6 .
Buitrago, L., Brochero, H., McKeon, S., Lainhart, W., & Conn, J. (2013). First
published record of urban malaria in Puerto Gaitán, Meta, Colombia. Mem Inst
Oswaldo Cruz 108(8):1045-1050 .
Cicery, E. (2005). Monografía del municipio de Puerto Gaitán; visión geohistórica y
cultural. 105pp.
DANE. (2010). Censo general 2005, Perfil Puerto Gaitán. 1-6.
Estrada, D., Quiñones, M., Sierra, D., Calle, D., Ruiz, F., Erazo, H., et al. (2003).
Utilidad de la morfología de los huevos como método indirecto para identificar
Anopheles benarrochi Gabaldón,Cova García & López, Anopheles oswaldoi
(Peryassu) y Anopheles rangeli Gabaldón, Cova García & López, (Diptera:Culicidae)
en Putumayo, Colombia. Biomédica 2003;23:388-95.
Capítulo 2 53
Faran, M. (1980). A revisión of the Albimanus section of the subgenus
Nyssorhynchus. Contrib Am Entomol Inst. 1980; 15:1-215. .
Faran, M., & Linthicum, K. (1981). A handbook of the Amazonian species of
Anopheles (Nyssorhynchus) (Diptera: Culicidae). Mosq Syst. 1981; 13:1-81.
Folmer, O., Black, M., Hoeh, W., Lutz, R., & Vrijenhoek, R. (1994). DNA primers for
amplification of mitochondrial Cytochrome c Oxidase subunit I from diverse metazoan
invertebrates. Mol Mar Biol Biotechnol 1994; 3: 294-299 .
Girod, R., Gaborit, P., Carinci, R., Issaly, J., & Fouque, F. (2008). Anopheles darlingi
bionomics and transmission of Plasmodium falciparum, Plasmodium vivax and
Plasmodium malariae in Amerindian villages of the Upper-Maroni Amazonian forest,
French Guiana. Mem. Inst. Oswaldo Cruz 103; 7: 702-710 .
González, R., & Carrejo, N. (2009). Introducción al estudio taxonómico de Anopheles
de Colombia: claves y notas de distribución. 2da edición. Programa editorial Univalle.
260pp.
Jiménez, P., Conn, J., Wirtz, R., & Brochero, H. (2012). Anopheles (Díptera:
Culicidae) vectores de malaria en el municipio de Puerto Carreño, Vichada,
Colombia. Biomédica 2012;32(Supl.):13-21.
MacDonald, G. (1957). The epidemiology and control of malaria. Oxford: Oxford
University Press.
Montoya-Lerma, J., Solarte, Y., Giraldo-Calderón, G., Quiñones, M., Ruiz-López, F.,
Wilkerson, R., et al. (2011). Malaria vector species in Colombia - A review. Mem Inst
Oswaldo Cruz. 2011 Aug;106 Suppl 1:223-38.
Ochoa, J., & Osorio, L. (2006). Epidemiología de malaria urbana en Quibdó, Chocó.
Biomédica 2006;26:278-85.
Olano, V., Brochero, H., Sáenz, R., Quiñones, M., & Molina, J. (2001). Mapas
preliminares de la distribución de especies de Anopheles vectores de malaria en
Colombia. Biomédica 2001;21:402-8.
Ratnasingham, S., & Hebert, P. (2007). bold: The Barcode of Life Data System
(http://www.barcodinglife.org). Mol Ecol Notes 1;7(3):355–364 .
Rubio-Palis, Y. (2000). Anopheles (Nyssorhynchus) de Venezuela: taxonomía,
bionomía, ecología e importancia médica. Escuela de Malariologia y Saneamiento
Ambiental. Maracay, Venezuela. 2000; 120p.
Rubio-Palis, Y., & Zimmerman, R. (1997). Ecoregional classification of malaria
vectors in the neotropics. J Med Entomol. 1997 Sep;34(5):499-510.
54 Determinación del papel en la transmisión de malaria de las especies de Anopheles
Ruiz, F., Wilkerson, R., Conn, J., McKeon, S., Levin, D., Quiñones, M., et al. (2012).
DNA barcoding reveals both known and novel taxa in the Albitarsis Group
(Anopheles: Nyssorhynchus) of Neotropical malaria vectors. Parasites and Vectors
5(44):1-12 .
Servicio de Erradicacion de la Malaria. (1957). Plan de Erradicación de la Malaria en
Colombia. Volumen I y II. Bogotá: Ministerio de Salud Nacional.
Singh, B., Bobogare, A., Cox-Singh, J., Snounou, G., Abdullah, M., & Rahman, H.
(1999). A genus- and species-specific nested polymerase chain reaction malaria
detection assay for epidemiologic studies. Am J Trop Med Hyg 60(4):687-92 .
The Walter Reed Biosystematics Unit. (n.d.). MEDICALLY IMPORTANT
MOSQUITOES. Retrieved January 20, 2014, from Southcom:
http://www.wrbu.org/SpeciesPages_ANO/ANO_A-hab/ANbra_hab.html
Warrell, D., & Gilles, H. (2002). Essential Malariology. 4th edition. New York. Oxford
University Press. 2002:192.
WHO. (1975). Manual on Practical Entomology in Malaria. Part II: Methods and
Techniques, Geneva, 191 pp.
WHO. (2013). World Malaria Report 2013. Geneva, Switzerland: WHO. pp284.
Wirtz, R. (2009). Sporozoite ELISA directions. Center for Disease Control and
Prevention, Atlanta, USA.
Wirtz, R., Burkot, T., Andre, R., Rosenberg, R., Collins, W., & Roberts, D. (1985).
Identification of Plasmodium vivax sporozoites in mosquitoes using an enzyme-linked
immunosorbent assay. Am Jour Trop Med Hyg 1985; 34: 1048-1054p .
Wirtz, R., Burkot, T., Graves, P., & Andre, R. (1987). Field evaluation of enzyme-linked immunosorbent assays for Plasmodium falciparum and Plasmodium vivax sporozoites in mosquitoes (Diptera: Culicidae) from Papua New Guinea. J Med Entomol. 1987;24:433-7.
3. Discusiones Generales
Al comparar la abundancia y composición de especies de las formas inmaduras halladas en los criaderos con la de las formas adultas capturadas mediante atrayente humano en las localidades se observan diferencias, esto puede deberse a diversos factores; uno de estos puede ser el sesgo impuesto debido al manejo y a la posible diferencia en la capacidad de sobrevivir bajo condiciones de laboratorio de los individuos de diferentes especies durante la obtención de series entomológicas, haciendo que los factores mencionados (abundancia y composición) observados no se correspondan. También, como se puede inferir con respecto a Pacurita (Chocó), estas diferencias se pueden deber al muestreo incompleto de los sitios de cría presentes en el área de estudio, ya sea por falta de detección de éstos, sesgo muestreal al no tener en cuenta sitios de cría como bromelias en la metodología seleccionada o por la simple inaccesibilidad a algunos que podrían ser de relevancia para la cría de especies de importancia epidemiológica. La no correspondencia entre la actividad de picadura y las abundancias en los sitios de cría de las especies recolectadas también puede deberse al tiempo de respuesta con retraso de las formas inmaduras y adultas a cambios ambientales estacionales como la precipitación (Reinbold-Wasson, et al., 2012). La diferencia en las especies predominantes de cada una de las localidades estudiadas se encuentra dentro de lo esperado en concordancia con la distribución conocida de las especies halladas y con la clasificación ecorregional de los vectores (Rubio-Palis & Zimmerman, 1997). Pacurita (Chocó), presenta condiciones ambientales naturales más óptimas para el éxito de An. nuneztovari que para el éxito de An. darlingi, situación que cambia en Puerto Gaitán donde las condiciones medioambientales son más favorables para An. darlingi, además de otras especies como An. albitarsis sl y An. braziliensis, además que An. albitarsis sl no se registra en Pacurita durante el presente estudio (Rubio-Palis & Zimmerman, 1997; Sinka, et al., 2010; Montoya-Lerma, et al., 2011). Además que el ambiente general de Puerto Gaitán no ofrece sitios de cría como bromelias, vegetación más asociada con el ambiente de Pacurita (Pino & Valois, 2004 ). En Pacurita, a diferencia de Puerto Gaitán se capturaron especies (An. neivai)
que pueden tener actividad de picadura diurna con capacidad de transmitir los
56 Discusiones Generales
parásitos de la malaria humana (Murillo, Astaiza, & Fajardo, 1988), esto genera la
necesidad de extender estrategias de protección como el uso de repelente hacia
las actividades diurnas, especialmente para aquellos pobladores con actividades
que se desarrollan en el entorno selvático donde habitan estas especies de
Anopheles, actividades como tala, pesca, cacería y extracción de oro
4. Conclusiones y recomendaciones
4.1 Conclusiones
Las diferencia observada entre Pacurita y Puerto Gaitán con respecto a la abundancia de An. darlingi puede deberse a las marcadas diferencias ambientales entre las localidades seleccionadas y a las presiones de selección supuestas sobre las poblaciones de este vector de malaria por el ser humano y por la competencia con las especies de Anopheles spp. halladas en cada localidad.
La composición de especies de Anopheles spp. está fuertemente ligada al medio
ambiente, es decir, a las características ecorregionales y a las diferentes presiones ejercidas por las actividades humanas.
La composición de tipos de sitios de cría positivos para Anopheles spp. hallada en
cada localidad está determinada por las características regionales de las localidades, las actividades humanas propias de las poblaciones y la bionomía de las especies registradas en éstas.
La presencia de An. darlingi y An. albitarsis sl en el área urbana de Puerto Gaitán
(Meta) parece una evidencia de una alta tolerancia a hábitats fuertemente intervenidos por actividades humanas.
La diferencia en prevalencia de las diferentes especies parasitarias de Plasmodium
podría estar determinada por factores adicionales al componente entomológico, la composición étnica característica de las poblaciones humanas de cada una de las localidades estudiadas se postula como un factor relevante para tal efecto.
Las intervenciones de control parecen tener un fuerte efecto en comunidades pequeñas, llegándose a observar una disminución casi absoluta de las densidades de Anopheles spp. y un corte en la transmisión de la enfermedad.
58 Determinación del papel en la transmisión de malaria de las especies de Anopheles
4.2 Recomendaciones
Para futuros estudios se sugiere evaluar componentes de ecología poblacional relevantes para el rol de las especies de Anopheles (especialmente en el caso de las especies pertenecientes a complejos de las cuales no exista mucho conocimiento, como en el caso de An. albitarsis F) en la transmisión de malaria, tales como la estructura de edades de las hembras silvestres capturadas para evaluar su supervivencia y así estimar la proporción de hembras que puedan a ser lo suficientemente longevas como para llegar a ser infectivas, esto es estimado tras disección y observación del sistema reproductivo de los ejemplares con el objetivo de inferir acerca de la cantidad de posturas realizadas. (Charlwood, 1980). Es importante potenciar estudios similares al presentado en este trabajo de grado con un componente adicional de evaluación de la susceptibilidad a insecticidas en poblaciones de Anopheles spp. de importancia médica. Se requiere de una completa incriminación vectorial de las especies pertenecientes a complejos de especies para así generar una línea base de estudios que fundamenten registros en nuevas localidades, esto a modo de preparación hacia escenarios futuros de transmisión de la malaria dentro del marco de la transformación antropogénica sobre los ecosistemas y el fenómeno del calentamiento global. Se recomienda fortalecer las redes de trabajo regionales para la vigilancia de la malaria y, asimismo, las redes de investigación nacionales para aumentar la cooperación técnica, optimizando la capacidad y los mecanismos de intercambio de conocimientos, para posibilitar la adopción de políticas y estrategias adecuadas para la prevención, y diagnóstico oportuno. De este modo se lograría disminuir la incidencia y prevalencia de la enfermedad y asimismo reducir las externalidades asociadas a ésta y finalmente potenciar el desarrollo rural del país.
Anexo A: Fotografías de sitios de cría del corregimiento de Pacurita, Quibdó (Choco, Colombia) 2010
Anexo A- 1. Sitios de cría de tipo recipiente artificial
Anexo A- 2. Sitios de cría de tipo excavación minera
60 Determinación del papel en la transmisión de malaria de las especies de Anopheles
Anexo A- 3. Sitios de cría de tipo huella de vehículo
Anexo A- 4. Sitios de cría de tipo pequeño dique con estanque
Anexo B: Fotografías de Sitio y viviendas muestreadas de Puerto Gaitán (Meta, Colombia) 2009.
Anexo B- 1. Sitío de cría del tipo Morichera (Crédito; Secretaría Seccional de Salud del Meta –
Colombia)
62 Determinación del papel en la transmisión de malaria de las especies de Anopheles
Anexo B- 2. Sitios de cría del tipo estanque piscícola (Crédito; Secretaría Seccional de Salud del
Meta –Colombia)
Anexo B. Fotografías de sitios y viviendas muestreadas de Puerto Gaitán… 63
Anexo B- 3. Sitio de cría de tipo margen de río (Crédito; Secretaría Seccional de Salud del Meta –
Colombia)
Anexo B- 4. Vivienda muestreada para captura de mosquitos adultos (Crédito; Secretaría
Seccional de Salud del Meta –Colombia)
64 Determinación del papel en la transmisión de malaria de las especies de Anopheles
Anexo C: Formularios empleados en campo y laboratorio.
Anexo C- 1. Formulario para la caracterización de criaderos de mosquitos Anopheles spp.
Anexo B. Fotografías de sitios y viviendas muestreadas de Puerto Gaitán… 65
Anexo C- 2. Formulario para procesamiendo en laboratorio de formas inmaduras de mosquitos
Anopheles spp. (Series entomológicas e Isofamilias)
Anexo C. Formularios empleados en campo y laboratorio. 65
66 Determinación del papel en la transmisión de malaria de las especies de Anopheles
Anexo C- 3. Formulario de captura mediante atrayente humano de Anopheles spp.
Anexo B. Fotografías de sitios y viviendas muestreadas de Puerto Gaitán… 67
Anexo D. Secuencia Barcode-COI de ejemplar An. albitarsis F infectado por P. falciparum capturado en Puerto Gaitán, Meta, Colombia
>MPG117-43 CTCAACCACATAAAGATATTGGAACTTTATATTTTATTTTTGGAGCCTGAGCTGGAATAGTAGGAACTTCATTAAGAATTCTAATTCGAGCTGAATTAGGTCATCCAGGAGCTTTTATTGGAGATGATCAAATTTATAATGTTATTGTAACTGCTCACGCATTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGGGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCCCCAGATATGGCATTCCCCCGAATAAATAATATAAGTTTTTGAATATTACCTCCTTCCTTAACTCTTTTAATTTCTAGAAGTATAGTAGAAAATGGAGCTGGAACAGGATGAACTGTTTACCCACCTCTTTCATCTGGAATTGCTCATGCTGGAGCTTCTGTTGATTTAGCAATTTTCTCTCTTCATTTAGCAGGGATTTCTTCAATTTTAGGAGCTGTAAATTTTATTACTACAGTTATTAATATACGATCTCCAGGGATTACATTAGATCGAATACCTTTATTTGTTTGATCAGTAGTAATTACAGCTGTACTATTATTACTATCATTGCCTGTATTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACATCATTCTTTGACCCTGCCGGAGGAGGAGACCCTATTTTATATCAACATTTATTCTGATTTTTTGGTCACCCCAAAGTTTAA
Bibliografía
Agudelo, C., Corredor, A., Echeverry, M., Salcedo, H., & Murraín, B. (1995).
Malaria: fundamentos y alcances del control Características en Colombia.
Infectio1995;1 (1):35-55 .
Ahern, M., Kovats, R., Wilkinson, P., Few, R., & Matthies, F. (2005). Global Health
Impacts of Floods: Epidemiologic Evidence. Epidemiol Rev 27(1): 36-46.
Ahmad, O., Boschi-Pinto, C., Lopez, A., Murray, C., Lozano, R., & Inoue, M.
(2001). Age standardization of rates; a new WHO standard. GPE Discussion
Paper Series: No.31 .
Ahumada, M. (2009). Determinación del papel como vector de malaria de las
especies de Anopheles presentes en el departamento del Meta, Colombia.
Universidad Nacional de Colombia, Facultad de Medicina, Infecciones y Salud en
el Trópico.
Ahumada, M. (2009). Determinación del papel como vector de malaria de las
especies de Anopheles presentes en el departamento del Meta, Colombia.
Universidad Nacional de Colombia, Facultad de Medicina, Infecciones y Salud en
el Trópico. 73.
Ahumada, M., Pareja, P., Buitrago, L., & M.L., Q. (2013). Comportamiento de
picadura de Anopheles darlingi Root, 1926 (Diptera: Culicidae) y su asociación
con la transmisión de malaria en Villavicencio (Meta, Colombia). Biomédica 2013;
33(2) .
Ahumada, M., Pareja, P., Buitrago, L., & Quiñones, M. (2013). Comportamiento
de picadura de Anopheles darlingi Root, 1926 (Diptera: Culicidae) y su asociación
con la transmisión de malaria en Villavicencio (Meta, Colombia). Biomédica 2013;
33(2) .
Altschul, S., Gish, W., Miller, W., Myers, E., & Lipman, D. (1990). Basic local
alignment search tool. J. Mol. Biol. 215:403-410.
70 Determinación del papel en la transmisión de malaria de las especies de Anopheles
Arevalo, M., Quiñones, M., & Guerra, C. (2012). Malaria in selected non-
Amazonian countries of Latin America. Acta Tropica 2012; 121: 303–314 .
Ayala, D., Constantini, C., Ose, K., G.C., K., Antonio-Nkondjio, C., Agbor, J., et al.
(2009). Habitat suitability and ecological niche profile of major malaria vectors in
Cameroon. Malar J 2009; 8:307.
Belkin, J., Schick, R., Galindo, P., & Aitken, T. (1967). Estudios sobre mosquitos
(Diptera: Culicidae). Ia. Un proyecto para un estudio sistemático de los mosquitos
de mesoamérica. Ila. Métodos para coleccionar, criar y preservar mosquitos.
Contrib Am Entomol Inst 1967; 1: 163-80.
Bigoga, J., Ndangoh, D., Awono-Ambene, P., Patchoke, S., Fondjo, E., & Leke, R.
(2012). Pyrethroid resistance in Anopheles gambiae from the rubber cultivated
area of Niete, South Region of Cameroon. Acta Trop 124(3): 210-4 .
Blair, S. (2012). Retos para la eliminación de la malaria en Colombia: un problema
de saber o de poder. Biomédica 2012;32(Supl.):131-48 .
Blaustein, L., & Chase, J. (2007). Interactions between mosquito larvae and
species that share the same trophic level. Annu Rev Entomol 2007; 52: 489–507 .
Bouma, M., Poveda, G., Rojase, W., Chavasesee, D., Quiñones, M., Cox, J., et al.
(1997). Predicting high risk years for malaria in Colombia using parameters of El
Niño Southen Oscillation. Trop Med Int Health 1997; 2: 1122-1127 .
Brasil, P., de Pina Costa, A., Pedro, R., da Silveira Bressan, C., da Silva, S., Tauil,
P., et al. (2011). Unexpectedly long incubation period of Plasmodium vivax
malaria, in the absence of chemoprophylaxis, in patients diagnosed outside the
transmission area in Brazil. Malar J 2011 ;10:122 .
Brochero, H., & Quiñones, M. (2008). Retos de la entomología médica para la
vigilancia en salud pública en Colombia: reflexión para el caso de malaria.
Biomédica 2008;28:18-24 .
Brochero, H., Li, C., & Wilkerson, R. (2007). A newly recognized species in the
Anopheles (Nyssorhynchus) albitarsis complex (Diptera: Culicidae) from Puerto
Carreño, Colombia. Am J Trop Med Hyg 2007;76(6):1113-7 .
Brochero, H., Pareja, P., Ortiz, G., & Olano, V. (2006). Sitios de cría y actividad de
picadura de especies de Anopheles en el municipio de Cimitarra, Santander,
Colombia. Biomédica 2006;26:269-77 .
Bibliografía 71
Brochero, H., Rey, G., Buitrago, L., & Olano, V. (2005). Biting activity and
breeding sites of Anopheles species in the municipality Villavicencio, Meta,
Colombia. J Am Mosq Control Assoc 2005;21(2):182-6 .
Buitrago, L., Brochero, H., McKeon, S., Lainhart, W., & Conn, J. (2013). First
published record of urban malaria in Puerto Gaitán, Meta, Colombia. Mem Inst
Oswaldo Cruz 108(8):1045-1050 .
Buitrago, L., Escobar, A., Peña, N., Conn, J., & Brochero, H. (2010). First record
of urban malaria in Puerto Gaitán, Meta. Colombia. 76th Annual Meeting of the
American Mosquito Control Association and 20th Latin American Symposium .
Cabral, A., Fé, N., Suárez, M., Bóia, M., & Carvalho, F. (2010). Increasing
incidence of malaria in the Negro River basin, Brazilian Amazon. Trans R Soc
Trop Med Hyg 2010; 104: 556–562 .
CDC. (9 de Noviembre de 2012). Center for Disease Control and Prevention
website. Recuperado el 10 de Diciembre de 2012, de
http://www.cdc.gov/malaria/malaria_worldwide/impact.html
CDC. (2010, Febrero 8). Centers for Disease Control and Prevention. Retrieved
Mayo 12, 2013, from Anopheles mosquitoes:
http://www.cdc.gov/malaria/about/biology/mosquitoes/
Chaparro, P. (2012). Informe del evento paludismo, hasta el período
epidemiológico 12 del año 2012. Instituto Nacional de Salud.
Chaparro, P. (2012). Mortalidad por paludismo, un vistazo desde el SIVIGILA,
Colombia. Inf Quinc Epidemiol Nac 2012;17(2):11-9 .
Charlwood, J. (1980). Observations on The bionomics of Anopheles darlingi Root
(Diptera: Culicidae) from Brazil. Bull Entomol Res 1980; 70(04): 685-692 .
Charlwood, J., & Alecrim, W. (1989). Capture-recapture studies with the South
American malaria vector Anopheles darlingi, Root. Ann Trop Med Parasitol
83(6):569-76 .
Cicery, E. (2005). Monografía del municipio de Puerto Gaitán; visión geohistórica
y cultural. 105pp.
Conn, J., & Mirabello, L. (2007). The biogeography and population genetics of
neotropical
vector species. Heredity 2007; 99: 245–256.
72 Determinación del papel en la transmisión de malaria de las especies de Anopheles
Conn, J., Wilkerson, R., Segura, M., de Souza, R., Schlichting, C., Wirtz, R., et al.
(2002). Emergence of a new neotropical malaria vector facilitated by human
migration and changes in land use. Am J Trop Med Hyg 2002; 66(1): 18-22.
Cox, F. (2010). History of the discovery of the malaria parasites and their vectors.
Parasit Vectors 2010;1;3(1):5 .
da Silva, M., Moreno, M., Conn, J., Gamboa, D., Abeles, S., Vinetz, J., et al.
(2012). Amazonian malaria: asymptomatic human reservoirs, diagnostic
challenges, environmentally driven changes in mosquito vector populations, and
the mandate for sustainable control strategies. Acta Trop 2012; 121(3): 281-91 .
DANE. (2010). Censo general 2005, Perfil Puerto Gaitán. 1-6.
Deane, L. (1986). Malaria vectors in Brazil. Mem Inst Oswaldo Cruz 1986; 81: 5-
14 .
Delgado, N., & Rubio-Palis, Y. (1993). Identification of Anopheles
(Nyssorhynchus) (Diptera: Culicidae) ocurring in western Venezuela. Mosq
System 1993; 25(2): 222-230 .
Diabate, A., Baldet, T., Chandre, F., Akoobeto, M., Guiguemde, T., Darriet, F., et
al. (2002). The role of agricultural use of insecticides in resistance to pyrethroids in
Anopheles gambiae s.l. in Burkina Faso. Am J Trop Med Hyg 2002; 67(6): 617-22
.
Djouaka, R., Bakare, A., Bankole, H., Doannio, J., Coulibaly, O., Kossou, H., et al.
(2007). Does the spillage of petroleum products in Anopheles breeding sites have
an impact on the pyrethroid resistance? Malar J 2007; 6: 159 .
Dusfour, I., Issaly, J., Carinci, R., Gaborit, P., & Girod, R. (2012). Incrimination of
Anopheles (Anopheles) intermedius Peryassú, An. (Nyssorhynchus) nuneztovari
Gabaldón, An. (Nys.) oswaldoi Peryassú as natural vectors of Plasmodium
falciparum in French Guiana. Mem Inst Oswaldo Cruz 2012; 107(3): 429-32 .
Eisen, L., & Eisen, R. (2011). Using geographic information systems and decision
support systems for the prediction, prevention, and control of vector-borne
diseases. Annu Rev Entomol. 2011;56:41-61 .
Elith, J., & Leathwick, J. (2009). Species Distribution Models: Ecological
Explanation and Prediction Across Space and Time. Ann Rev Ecol Evol Syst Vol.
40: 677-697 .
Elliot, R. (1968). Studies on man-vector contact in some malarious areas in
Colombia. Bull Wld Hlth Org 1968: 38; 239-253 .
Bibliografía 73
Enayati, A., & Hemingway, J. (2010). Malaria management: past, present, and
future. Annu Rev Entomol 2010; 55: 569-91 .
Estrada, D., Quiñones, M., Sierra, D., Calle, D., Ruiz, F., Erazo, H., et al. (2003).
Utilidad de la morfología de los huevos como método indirecto para identificar
Anopheles benarrochi Gabaldón,Cova García & López, Anopheles oswaldoi
(Peryassu) y Anopheles rangeli Gabaldón, Cova García & López,
(Diptera:Culicidae) en Putumayo, Colombia. Biomédica 2003;23:388-95.
Fajardo, M., González, R., Fidel, M., López, D., Wilkerson, R., & Sallum, M.
(2008). Morphological analysis of three populations of Anopheles
(Nyssorhynchus) nuneztovari Gabaldón (Diptera: Culicidae) from Colombia. Mem
Inst Oswaldo Cruz 2008;103(1):85-92 .
Fane, M., Cissé, O., Traore, C., & Sabatier, P. (2012). Anopheles gambiae
resistance to pyrethroid-treated nets in cotton versus rice areas in Mali. Acta Trop
122(1): 1-6 .
Faran, M. (1980). A revisión of the Albimanus section of the subgenus
Nyssorhynchus. Contrib Am Entomol Inst. 1980; 15:1-215. .
Faran, M., & Linthicum, K. (1981). A handbook of the Amazonian species of
Anopheles (Nyssorhynchus) (Diptera: Culicidae). Mosq Syst. 1981; 13:1-81.
Faran, M., & Linthicum, K. (1981). A handbook of the Amazonian species of
Anopheles (Nyssorhynchus). Mosq Syst 1981;13:1–85.
Fillinger, U., & Lindsay, S. (2011). Larval source management for malaria control
in Africa: myths and reality. Malar J. 2011 Dec 13;10:353.
Fillinger, U., Sonye, G., Killeen, G., Knols, B., & Becker, N. (2004). The practical
importance of permanent and semipermanent habitats for controlling aquatic
stages of Anopheles gambiae sensu lato mosquitoes: operational observations
from a rural town in western Kenya. Trop Med Int Health. 2004 Dec;9(12):1274-
89.
Fleming, G. (1986). Biología y ecología de los vectores de la malaria en las
Américas. Washington D.C.: Organización Panamericana de la Salud. p.13-6.
Folmer, O., Black, M., Hoeh, W., Lutz, R., & Vrijenhoek, R. (1994). DNA primers
for amplification of mitochondrial Cytochrome c Oxidase subunit I from diverse
metazoan invertebrates. Mol Mar Biol Biotechnol 1994; 3: 294-299 .
74 Determinación del papel en la transmisión de malaria de las especies de Anopheles
Fonseca, I., Cárdenas, R., G. W., Santacoloma, L., Brochero, H., O. C., et al.
(2010). Dosis diagnósticas para vigilar la resistencia a insecticidas de los vectores
de malaria en Colombia. Rev. Colomb. Entomol. v.36 n.1 Bogotá ene./jun. 2010.
Forattini, O., Kakitani, I., Massad, E., & Marucci, D. (1993). Studies on mosquitoes
(Diptera: Culicidae) and anthropic environment. 4 - Survey of resting adults and
synanthropic behaviour in South-Eastern, Brazil. Rev. Saúde Pública, 27 (6);398-
411.
Forattini, O., Kakitani, I., Massad, E., & Marucci, D. (1995). Studies on mosquitoes
(Diptera: Culicidae) and anthropic environment. 7- Behaviour of adults
Nyssorhynchus anophelines with special reference to Anopheles albitarsis s.l. in
South-Eastern Brazil. Rev. Saúde Pública, 29 (10);20-6.
Fournet, F., Cussac, M., Ouari, A., Meyer, P., Toé, H., Gouagna, L., et al. (2010).
Diversity in anopheline larval habitats and adult composition during the dry and
wet seasons in Ouagadougou (Burkina Faso). Malar J. 2010 Mar 19;9:78.
Galardo, A., Zimmerman, R., Lounibos, L., Young, L., Galardo, C., Arruda, M., et
al. (2009). Seasonal abundance of anopheline mosquitoes and their association
with rainfall and malaria along the Matapí River, Amapá, Brazil. Med Vet Entomol.
2009 Dec;23(4):335-49.
Gething, P., Van Boeckel, T., Smith, D., Guerra, C., Patil, A., Snow, R., et al.
(2011). Modelling the global constraints of temperature on transmission of
Plasmodium falciparum and P. vivax. Parasit Vectors. 2011 May 26;4:92.
Gil, L., Tada, M., Katsuragawa, T., Ribolla, P., & da Silva, L. (2007). Urban and
suburban malaria in Rondônia (Brazilian Western Amazon) II. Perennial
transmissions with high anopheline densities are associated with human
environmental changes. Mem Inst Oswaldo Cruz. 2007 Jun;102(3):271-6.
Girod, R., Gaborit, P., Carinci, R., Issaly, J., & Fouque, F. (2008). Anopheles
darlingi bionomics and transmission of Plasmodium falciparum, Plasmodium vivax
and Plasmodium malariae in Amerindian villages of the Upper-Maroni Amazonian
forest, French Guiana. Mem. Inst. Oswaldo Cruz 103; 7: 702-710 .
Godfray, H. (2013). Mosquito ecology and control of malaria. J Anim Ecol. 2013
Jan;82(1):15-25.
Gomes Ade, C., Paula, M., Natal, D., Gotlieb, S., & Mucci, L. (2010). Effects of
flooding of
Bibliografía 75
the River Paraná on the temporal activity of Anopheles (Nyssorhynchus) darlingi
Root (Diptera: Culicidae), at the border state of Mato Grosso do Sul and São
Paulo, Brazil. Rev Soc Bras Med Trop. 2010 Sep-Oct;43(5):516-22.
González, R., & Carrejo, N. (2009). Introducción al estudio taxonómico de
Anopheles de Colombia: claves y notas de distribución. 2da edición. Programa
editorial Univalle. 260pp.
Grech, K., Maung, L., & Read, A. (2007). The effect of parental rearing conditions
on offspring life history in Anopheles stephensi. Malaria Journal 2007, 6:130.
Greenwood, B., Bojang, K., Whitty, C., & Targett, G. (2005). Malaria. Lancet 365:
1487–98 .
Grillet, M., Barrera, R., Martínez, J., Berti, J., & Fortin, M. (2010). Disentangling
the Effect of Local and Global Spatial Variation on a Mosquito-Borne Infection in a
Neotropical Heterogeneous Environment. Am J Trop Med Hyg. 2010
Feb;82(2):194-201.
Gutiérrez, L., González, J., Gómez, G., Castro, M., Rosero, D., Luckhart, S., et al.
(2009). Species composition and natural infectivity of anthropophilic Anopheles
(Diptera: Culicidae) in the states of Córdoba and Antioquia, Northwestern
Colombia. Mem Inst Oswaldo Cruz. 2009 Dec;104(8):1117-24.
Harris, A., Matias, A., & Hill, N. (2006). Biting time of Anopheles darlingi in the
Bolivian Amazon and implications for control of malaria. Trans R Soc Trop Med
Hyg. 2006 Jan;100(1):45-7.
Herrera, S., Suárez, M., Sánchez, G., Quiñones, M., & Herrera, M. (1987). Uso de
la técnica inmunoradiométrica (IRMA) en Anopheles de Colombia para la
identificación de esporozoítos de Plasmodium. Colombia Médica. 1987;18:57-60.
Hijmans, R., Cameron, S., Parra, J., Jones, P., & Jarvis, A. (2005). Very high
resolution interpolated climate surfaces for global land areas. International Journal
of Climatology 25: 1965-1978.
Hiwat, H., & Bretas, G. (2011). Ecology of Anopheles darlingi Root with respect to
vector importance: a review. Parasit Vectors. 2011 Sep 16;4:177.
Hiwat, H., Issaly, J., Gaborit, P., Somai, A., Samjhawan, A., Sardjoe, P., et al.
(2010). Behavioral heterogeneity of Anopheles darlingi (Diptera: Culicidae) and
malaria transmission dynamics along the Maroni River, Suriname, French Guiana.
Trans R Soc Trop Med Hyg. 2010 Mar;104(3):207-13.
76 Determinación del papel en la transmisión de malaria de las especies de Anopheles
Hoshen, M., & Morse, A. (2004). A weather-driven model of malaria transmission.
Malar J. 2004 Sep 6;3:32.
Jacob, B., Muturi, E., Halbig, P., Mwangangi, J., Wanjogu, R., Mpanga, E., et al.
(2007). Environmental abundance of Anopheles (Diptera: Culicidae) larval habitats
on land cover change sites in Karima Village, Mwea Rice Scheme, Kenya. Am J
Trop Med Hyg. 2007 Jan;76(1):73-80.
Jaramillo, L., Gutiérrez, L., Luckhart, S., Conn, J., & Correa, M. (2011). Molecular
evidence for a single taxon, Anopheles nuneztovari s.l., from two endemic malaria
regions in Colombia. Mem Inst Oswaldo Cruz. 2011 Dec;106(8):1017-23.
Jiménez, P., Conn, J., Wirtz, R., & Brochero, H. (2012). Anopheles (Díptera:
Culicidae) vectores de malaria en el municipio de Puerto Carreño, Vichada,
Colombia. Biomédica 2012;32(Supl.):13-21.
Juliano, S. (2009). Species interactions among larval mosquitoes: context
dependence across habitat gradients. Annu Rev Entomol. 2009;54:37-56.
Katholi, C., & Unnasch, T. (2006). Important experimental parameters for
determining infection rates in arthropod vectors using pool screening approaches.
Am J Trop Med Hyg. 2006 May;74(5):779-85.
Kaufman, M., Wanja, E., Maknojia, S., Bayoh, M., Vulule, J., & Walker, E. (2006).
Importance of algal biomass to growth and development of Anopheles gambiae
larvae. J Med Entomol. 2006 Jul;43(4):669-76.
Koenraadt, C., Paaijmans, K., Schneider, P., Githeko, A., & Takken, W. (2006).
Low larval vector survival explains unstable malaria in the western Kenya
highlands. Trop Med Int Health. 2006 Aug;11(8):1195-205.
Krzywinski, J., Li, C., Morris, M., Conn, J., Lima, J., Povoa, M., et al. (2011).
Analysis of the evolutionary forces shaping mitochondrial genomes of a
Neotropical malaria vector complex. Mol Phylogenet Evol. 2011 March; 58(3):
469–477.
Lehane, M. (1991). Biology of blood-sucking insects. HarperCollins Academic
(London), xv, 288 p.
León, W., Valle, J., Naupay, R., Tineo, E., Rosas, A., & Palomino, M. (2003).
Comportamiento estacional del Anopheles (Nyssorhynchus) darlingi Root 1962 en
localidades de Loreto y Madre de Dios, Peru 1999-2000. Rev Peru Med Exp
Salud Publica 2003, 20:22-27.
Bibliografía 77
Li, C., & Wilkerson, R. (2007). Intragenomic rDNA ITS2 variation in the neotropical
Anopheles (Nyssorhynchus) albitarsis complex (Diptera: Culicidae). J Hered 2007
Jan-Feb;98(1):51-9.
Lindblade, K., Dotson, E., Hawley, W., Bayoh, N., Williamson, J., Mount, D., et al.
(2005). Evaluation of long-lasting insecticidal nets after 2 years of household use.
Trop Med Int Health 2005 Nov;10(11):1141-50.
Loaiza, J., Bermingham, E., Sanjur, O., Scott, M., Bickersmith, S., & Conn, J.
(2012). Review of genetic diversity in malaria vectors (Culicidae: Anophelinae).
Infect Genet Evol. 2012 Jan;12(1):1-12.
Lounibos, L. (2002). Invasions by insect vectors of human disease. Annu Rev
Entomol. 2002;47:233-66.
Loureço-de-Oliveira, R., Guimarães, A., Arle, M., da Silva, T., Castro, M., Mottta,
M., et al. (1989). Anopheline species, some of their habits and relation to malaria
in endemic areas of Rondônia State, Amazon region of Brazil. Rev Bras Biol 49:
393-397.
Lourenço-de-Oliveira, R., Guimarães, A., Arlé, M., da Silva, T., Castro, M., Motta,
M., et al. (1989). Anopheline species, some of their habits and relation to malaria
in endemic areas of Rondônia State, Amazon region of Brazil. Mem Inst Oswaldo
Cruz. 1989 Oct-Dec;84(4):501-14.
MacDonald, G. (1957). The epidemiology and control of malaria. Oxford: Oxford
University Press.
Magris, M., Rubio-Palis, Y., Menares, C., & Villegas, L. (2007). Vector bionomics
and malaria transmission in the Upper Orinoco River, Southern Venezuela. Mem
Inst Oswaldo Cruz. 2007 Jun;102(3):303-11.
Majambere, S., Fillinger, U., Sayer, D., Green, C., & Lindsay, S. (2008). Spatial
distribution of mosquito larvae and the potential for targeted larval control in The
Gambia. Am J Trop Med Hyg. 2008 Jul;79(1):19-27..
Manguin, S., Wilkerson, R., Conn, J., Rubio-Palis, Y., Danoff-Burg, J., & Roberts,
D. (1999). Population structure of the primary malaria vector in South America,
Anopheles darlingi, using isozyme, random amplified polymorphic DNA, internal
transcribed spacer 2, and morphologic markers. Am J Trop Med Hyg. 1999
Mar;60(3):364-76.
78 Determinación del papel en la transmisión de malaria de las especies de Anopheles
Mantilla, G., Oliveros, H., & Barnston, A. (2009). The role of ENSO in
understanding changes in Colombia's annual malaria burden by region, 1960–
2006. Malar J. 2009; 8: 6.
Martins-Campos, K., Pinheiro, W., Vítor-Silva, S., Siqueira, A., Melo, G.,
Rodrigues, I., et al. (2012). Integrated vector management targeting Anopheles
darlingi populations decreases malaria incidence in an unstable transmission
area, in the rural Brazilian Amazon. Malar J. 2012 Oct 23;11:351.
McKeon, S., Lehr, M., Wilkerson, R., Ruiz, J., Sallum, M., Lima, J., et al. (2010).
Lineage divergence detected in the malaria vector Anopheles marajoara (Diptera:
Culicidae) in Amazonian Brazil. Malar J. 2010 Oct 7;9:271.
McKeon, S., Schlichting, C., Povoa, M., & Conn, J. (2013). Ecological suitability
and spatial distribution of five anopheles species in amazonian Brazil. Am J Trop
Med Hyg 2013; 88(6): 1079-86 .
Mendoza, M., Nicholls, R., Olano, V., & Cortés, L. (2000). Situación de la malaria
en Colombia. Manual de manejo integrado de la malaria. Bogotá, INS.
Mendoza, N., Rosas, A., & Burgos, J. (2011). Evaluación de la aplicación de
pruebas de diagnóstico rápido para malaria como parte de una estrategia integral
para su control en Colombia. Biomédica 2011;31:55-69.
Merritt, R., Dadd, R., & Walker, E. (1992). Feeding behavior, natural food, and
nutritional relationships of larval mosquitoes. Annu Rev Entomol 1992.37:349-76 .
Merritt, T., Young, C., Vogt, R., Wilkerson, R., & Quattro, J. (2005). Intron
retention identifies a malaria vector within the Anopheles (Nyssorhynchus)
albitaris complex (Diptera: Culicidae). Mol Phylogenet Evol. 2005 Jun;35(3):719-
24.
Minakawa, N., Munga, S., Atieli, F., Mushinzimana, E., Zhou, G., Githeko, A., y
otros. (2005). Spatial distribution of anopheline larval habitats in Western Kenyan
highlands: effects of land cover types and topography. Am J Trop Med Hyg. 2005
Jul;73(1):157-65.
Minakawa, N., Mutero, C., Githure, J., Beier, J., & Yan, G. (1999). Spatial
distribution and habitat characterization of anopheline mosquito larvae in Western
Kenya. Am J Trop Med Hyg. 1999 Dec;61(6):1010-6.
Minakawa, N., Seda, P., & Yan, G. (2002). Influence of host and larval habitat
distribution on the abundance of African malaria vectors in western Kenya. Am J
Trop Med Hyg. 2002 Jul;67(1):32-8.
Bibliografía 79
Mirabello, L., & Conn, J. (2006). Molecular population genetics of the malaria
vector Anopheles darlingi in Central and South America. Heredity (2006) 96, 311–
321.
Mirabello, L., & Conn, J. (2008). Population analysis using the nuclear white gene
detects Pliocene/Pleistocene lineage divergence within Anopheles nuneztovari in
South America. Medical and Veterinary Entomology, 22, 109–119.
Molina, A. (2008). Sistemas de información geográfica para el análisis de la
distribución espacial de la malaria en Colombia. Revista EIA Número 9, p. 91-111.
Monsalve, S., Mattar, S., & González, M. (2009). Zoonosis transmitidas por
animales silvestres y su impacto en las enfermedades emergentes y
reemergentes. Rev.MVZ Córdoba 14(2):1762-1773, 2009.
Montoya-Lerma, J., Solarte, Y., Giraldo-Calderón, G., Quiñones, M., Ruiz-López,
F., Wilkerson, R., et al. (2011). Malaria vector species in Colombia - A review.
Mem Inst Oswaldo Cruz. 2011 Aug;106 Suppl 1:223-38.
Moreno, J., Rubio-Palis, Y., Páez, E., Pérez, E., & Sánchez, V. (2007).
Abundance, biting behaviour and parous rate of anopheline mosquito species in
relation to malaria incidence in gold-mining areas of southern Venezuela. Med Vet
Entomol. 2007 Dec;21(4):339-49.
Moreno, M., Bickersmith, S., Harlow, W., Hildebrandt, J., McKeon, S., Silva-do-
Nascimento, T., et al. (2013). Phylogeography of the neotropical Anopheles
triannulatus complex (Diptera: Culicidae) supports deep structure and complex
patterns. Parasit Vectors. 2013 Feb 22;6:47.
Munga, S., Yakob, L., Mushinzimana, E., Zhou, G., Ouna, T., Minakawa, N., et al.
(2009). Land use and land cover changes and spatiotemporal dynamics of
anopheline larval habitats during a four-year period in a highland community of
Africa. Am J Trop Med Hyg. 2009 Dec;81(6):1079-84.
Murillo, C., Astaiza, R., & Fajardo, P. (1988). Biologia de Anopheles (Kerteszia)
neivai H., D. & K., 1913 (Diptera: Culicidae) en la costa Pacífica de Colombia. I.
Fluctuación de la población larval y características de sus criaderos. Rev. Saúde
Pública vol.22 no.2.
Murillo, C., Astaiza, R., & Fajardo, P. (1988). Biologia de Anopheles (Kerteszia)
neivai H., D. & K., 1913 (Diptera: Culicidae) en la Costa Pacífica de Colombia. III.
Medidas de luminosidad y el comportamiento de picadura. Rev. Saúde Pública
vol.22 no.2.
80 Determinación del papel en la transmisión de malaria de las especies de Anopheles
Murillo, C., Jaramillo, C., Quintero, J., & Suarez, M. (1989). Biología de Anopheles
(Kerteszia) neivai H., D. & K., 1913 (Diptera: Culicidae) en la Costa Pacifica de
Colombia. IV – Estructura etárea y transmisión de malaria. Rev. Saúde Pública
vol.23 no.5.
Mushinzimana, E., Munga, S., Minakawa, N., Li, L., Feng, C., Bian, L., et al.
(2006). Landscape determinants and remote sensing of anopheline mosquito
larval habitats in the western Kenya highlands. Malaria Journal 2006, 5:13.
Nagm, L., Luitgards-Moura, J., Neucamp, C., Monteiro-de-Barros, F., Honório, N.,
Tsouris, P., et al. (2007). Affinity and diversity indices for anopheline immature
forms. Rev. Inst. Med. trop. 49(5):309-316.
Ochoa, J., & Osorio, L. (2006). Epidemiología de malaria urbana en Quibdó,
Chocó. Biomédica 2006;26:278-85.
Oksanen, J., Guillaume, F., Kindt, R., Legendre, P., Minchin, P., O'Hara, R., et al.
(2011). vegan: Community Ecology Package. R package.
Olano, V., Brochero, H., Sáenz, R., Quiñones, M., & Molina, J. (2001). Mapas
preliminares de la distribución de especies de Anopheles vectores de malaria en
Colombia. Biomédica 2001;21:402-8.
Olano, V., Carrasquilla, G., & Méndez, F. (1997). Transmisión de la malaria
urbana en Buenaventura, Colombia: aspectos entomológicos. Rev Panam Salud
Publica vol.1 n.4. .
Osorio, L. (2006). El control de la malaria en la costa Pacífica colombiana.
Biomédica 2006;26:3.
Osorio, L., & Suárez, M. (2012). Requisitos para una nueva historia de la malaria.
Biomédica 2012;32:1.
Osorio, L., Todd, J., & Bradley, D. (2004). Ausencia de malaria asintomática en
escolares de Quibdó, Chocó. Biomédica 24:13-19.
Osorio, L., Todd, J., & Bradley, D. (2004). Travel histories as risk factors in the
analysis of urban malaria in Colombia. Am J Trop Med Hyg. 2004 Oct;71(4):380-6.
Osorio, S. (2011). Lo invisible de las emergencias. Biomédica 2011;31:1.
Ospina, O., & L. J. (2012). Caracterización de la Red Nacional de Diagnóstico de
Malaria, Colombia, 2006-2010. Biomedica. 2012 Mar;32 Suppl 1 .
Bibliografía 81
Padilla, J., Álvarez, G., Montoya, R., Chaparro, P., & Herrera, s. (2011).
Epidemiology and control of malaria in Colombia. Mem. Inst. Oswaldo Cruz
106(Suppl. 1), 114-122.
PAHO. (2006). Regional Strategic Plan for Malaria in the Americas 2006-2010.
Washington, D.C. PAHO. 85pp.
Parmesan, C. (2006). Ecological and evolutionary responses to recent climate
change. Annu. Rev. Ecol. Evol. Syst. 2006. 37:637–69.
Pates, H., & Curtis, C. (2005). Mosquito behavior and vector control. Annu Rev
Entomol. 2005;50:53-70.
Pino, N., & Valois, H. (2004 ). Ethnobotany of Four Black communities of the
Municipality of Quibdó -Chocó, Colombia. Lyonia, 7: 59-68.
POT - Quibdó. (2012). Plan de Ordenamiento Territorial - Municipio de Quibdó.
Poveda, G., & Rojas, W. (1997). Evidencias de la asociación entre brotes
epidémicos de malaria en Colombia y el fenómeno El Niño-Oscilación del Sur
(ENSO). Rev Acad Colombiana de Ciencias Exactas, Físicas y Naturales 21: 421-
429.
Poveda, G., Estrada, O., Morales, J., Hernández, O., Galeano, A., & Osorio, S.
(2011). Integrating knowledge and management regarding the climate–malaria
linkages in Colombia. Current Opinion in Environmental Sustainability 2011,
3:448–460.
Póvoa, M., Conn, J., Schlichting, C., Amaral, J., Segura, M., Da Silva, A., et al.
(2003). Malaria vectors, epidemiology, and the re-emergence of Anopheles
darlingi in Belém, Pará, Brazil. J Med Entomol. 2003 Jul;40(4):379-86.
Póvoa, M., de Souza, R., Lacerda, R., Rosa, E., Galiza, D., de Souza, J., et al.
(2006). The importance of Anopheles albitarsis E and An. darlingi in human
malaria transmission in Boa Vista, state of Roraima, Brazil. Mem Inst Oswaldo
Cruz. 2006 Mar;101(2):163-8.
Ratnasingham, S., & Hebert, P. (2007). bold: The Barcode of Life Data System
(http://www.barcodinglife.org). Mol Ecol Notes 1;7(3):355–364 .
Reinbold-Wasson, D., Sardelis, M., Jones, J., Watts, D., Fernandez, R., Carbajal,
F., et al. (2012). Determinants of Anopheles seasonal distribution patterns across
a forest to periurban gradient near Iquitos, Peru. Am J Trop Med Hyg. 2012
Mar;86(3):459-63. .
82 Determinación del papel en la transmisión de malaria de las especies de Anopheles
Rejmankova, E., Savage, H., Rejmanek, M., Arredondo-Jimenez, J., & Roberts, D.
(1991). Multivariate analysis of relationships between habitats, environmental
factors and occurrence of Anopheline mosquito larvae Anopheles albimanus and
A. pseudopunctipennis in southern Chiapas, Mexico. Journal of Applied Ecology,
Vol. 28, No. 3. pp. 827-841.
Rodrígues, J. (2010). Método para la predicción de la dinámica temporal de la
malaria en los municipios de Colombia. Rev Panam Salud Publica 27(3), 2010.
Rojas, W., Botero, S., & Garcia, H. (2001). An integrated malaria control program
with community participation on the Pacific Coast of Colombia. Cadernos de
Saúde Pública Vol 17 suppl p.103-113.
Romero, M., Galindo, G., Otero, J., & Armenteras, D. (2004). Ecosistemas de la
cuenca del Orinoco colombiano. Instituto de Investigación de Recursos Biológicos
Alexander von Humboldt. Bogotá, Colombia. 189 p.
Rosa-Freitas, M., Lourenço-de-Oliveira, R., de Carvalho-Pinto, C., Flores-
Mendoza, C., & Silva-do-Nascimento, T. (1998). Anopheline species complexes in
Brazil. Current knowledge of those related to malaria transmission. Mem Inst
Oswaldo Cruz. 1998 Sep-Oct;93(5):651-5.
Rosa-Freitas, M., Tsouris, P., Peterson, A., Honório, N., de Barros, F., de Aguiar,
D., et al. (2007). An ecoregional classification for the state of Roraima, Brazil: the
importance of landscape in malaria biology. Mem Inst Oswaldo Cruz. 2007
Jun;102(3):349-57.
Rubio-Palis, Y. (2000). Anopheles (Nyssorhynchus) de Venezuela: taxonomía,
bionomía, ecología e importancia médica. Escuela de Malariologia y Saneamiento
Ambiental. Maracay, Venezuela. 2000; 120p.
Rubio-Palis, Y. (1998). Caracterización morfométrica de poblaciones del vector de
malaria Anopheles ( Nyssorhynchus ) darlingi Root (Diptera: Culicidae) en
Venezuela. Bol Entomol Venez 13: 141-172. .
Rubio-Palis, Y., & Zimmerman, R. (1997). Ecoregional classification of malaria
vectors in the neotropics. J Med Entomol. 1997 Sep;34(5):499-510.
Rubio-Palis, Y., Menare, C., Quinto, A., Magris, M., & Amarista, M. (2005).
Caracterización de criaderos de anofelinos (Diptera: Culicidae) vectores de
malaria del Alto Orinoco, Amazonas, Venezuela. Entomotropica 20: 29-38.
Bibliografía 83
Rubio-Palis, Y., Moreno, J., Bevilacqua, M., Medina, D., Martínez, Á., Cardenas,
L., et al. (2010). Caracterización ecológica de los anofelinos y otros culícidos en
territorio. Bol Mal Salud Amb v.50 n.1.
Ruiz, D., Poveda, G., Vélez, I., Quiñones, M., Rúa, G., Velásquez, L., et al.
(2006). Modelling entomological-climatic interactions of Plasmodium falciparum
malaria transmission in two Colombian endemic-regions: contributions to a
National Malaria Early Warning System. Malar J 2006; 5: 66.
Ruiz, F., Wilkerson, R., Conn, J., McKeon, S., Levin, D., Quiñones, M., et al.
(2012). DNA barcoding reveals both known and novel taxa in the Albitarsis Group
(Anopheles: Nyssorhynchus) of Neotropical malaria vectors. Parasites and
Vectors 5(44):1-12 .
Sallum, M., Marrelli, M., Nagaki, S., Laporta, G., & Dos Santos, C. (2008). Insight
into Anopheles (Nyssorhynchus) (Diptera: Culicidae) species from Brazil. J Med
Entomol. 2008 Nov;45(6):970-81.
Schowalter, T. (2012). Insect responses to major landscape-level disturbance.
Annu. Rev. Entomol. 2012. 57:1–20.
Service, M. (1993). Mosquito Ecology, Field sampling methods. Ed. Chapman &
Hall. London, U.K.
Service, M. (1971). Studies on sampling larval populations of the Anopheles
gambiae complex. Bull World Health Organ. 1971;45(2):169-80.
Servicio de Erradicacion de la Malaria. (1957). Plan de Erradicación de la Malaria
en Colombia. Volumen I y II. Bogotá: Ministerio de Salud Nacional.
Sierra, D., Velez, I., & Linton, Y. (2004). Malaria vector anopheles
(Nyssorhynchus) nuneztovari comprises one genetic species in colombia based
on homogeneity of nuclear ITS2 rDNA. J Med Entomol. 2004 May;41(3):302-7.
Singh, B., Bobogare, A., Cox-Singh, J., Snounou, G., Abdullah, M., & Rahman, H.
(1999). A genus- and species-specific nested polymerase chain reaction malaria
detection assay for epidemiologic studies. Am J Trop Med Hyg 60(4):687-92 .
Sinka, M., Bangs, M., Manguin, S., Rubio-Palis, Y., Chareonviriyaphap, T.,
Coetzee, M., et al. (2012). A global map of dominant malaria vectors. Parasit
Vectors. 2012 Apr 4;5:69.
Sinka, M., Rubio-Palis, Y., Manguin, S., Patil, A., Temperley, W., Gething, P., et
al. (2010). The dominant Anopheles vectors of human malaria in the Americas:
84 Determinación del papel en la transmisión de malaria de las especies de Anopheles
occurrence data, distribution maps and bionomic précis. Parasit Vectors. 2010
Aug 16;3:72.
SIVIGILA. (2009). Vigilancia rutinaria Semana Epidemiológica 51 - Del Domingo,
20 de Diciembre de 2009 al Sábado, 26 de Diciembre de 2009. Instituto Nacional
de Salud.
Solarte, Y., Hurtado, C., Gonzalez, R., & Alexander, B. (1996). Man-biting activity
of Anopheles (Nyssorhynchus) albimanus and An. (Kerteszia) neivai (Diptera:
Culicidae) in the Pacific lowlands of Colombia. Mem Inst Oswaldo Cruz. 1996
Mar-Apr;91(2):141-6.
Souza-Santos, R., de Oliveira, M., Escobar, A., Santos, R., & Coimbra, C. J.
(2008). Spatial heterogeneity of malaria in Indian reserves of southwestern
Amazonia, Brazil. Int J Health Geogr 2008 Nov 3;7:55.
Suarez, M., Quiñones, M., Palacios, J., & Carrillo, A. (1990). First record of DDT
resistance in Anopheles darlingi. J. Am. Mosq. Control Assoc. 6, 72–74.
Sweeney, A., Beebe, N., Cooper, R., Bauer, J., & Peterson, A. (2006).
Environmental factors associated with distribution and range limits of malaria
vector Anopheles farauti in Australia. J Med Entomol. 2006 Sep;43(5):1068-75.
Tadei, W., & Dutary Thatcher, B. (2000). Malaria vectors in the Brazilian amazon:
Anopheles of the subgenus Nyssorhynchus. Rev Inst Med Trop Sao Paulo. 2000
Mar-Apr;42(2):87-94.
Tadei, W., Thatcher, B., Santos, J., Scarpassa, V., Rodrigues, I., & Rafael, M.
(1998). Ecologic observations on anopheline vectors of malaria in the Brazilian
Amazon. Am J Trop Med Hyg. 1998 Aug;59(2):325-35.
ter Brak, C. (1986). Canonical Correspondence Analysis: A New Eigenvector
Technique for Multivariate Direct Gradient Analysis. Ecology 67: 1167–1179 .
The Walter Reed Biosystematics Unit. (n.d.). MEDICALLY IMPORTANT
MOSQUITOES. Retrieved January 20, 2014, from Southcom:
http://www.wrbu.org/SpeciesPages_ANO/ANO_A-hab/ANbra_hab.html
Trape, J., Lefebvre-Zante, E., Legros, F., Ndiaye, G., Bouganali, H., Druilhe, P., et
al. (1992). Vector density gradients and the epidemiology of urban malaria in
Dakar, Senegal. Am J Trop Med Hyg. 1992 Aug;47(2):181-9.
Van Der Hoek, W., Konradsen, F., Amerasinghe, P., Perera, D., Piyaratne, M., &
Amerasinghe, F. (2003). Towards a risk map of malaria for Sri Lanka: the
Bibliografía 85
importance of house location relative to vector breeding sites. Int J Epidemiol.
2003 Apr;32(2):280-5.
Vittor, A., Gilman, R., Tielsch, J., Glass, G., Shields, T., Lozano, W., et al. (2006).
The effect of deforestation on the human-biting rate of Anopheles darlingi, the
primary vector of Falciparum malaria in the Peruvian Amazon. Am J Trop Med
Hyg 2006 Jan;74(1):3-11.
Vittor, A., Pan, W., Gilman, R., Tielsch, J., Glass, G., Shields, T., et al. (2009).
Linking deforestation to malaria in the Amazon: characterization of the breeding
habitat of the principal malaria vector, Anopheles darlingi. Am J Trop Med Hyg.
2009 Jul;81(1):5-12.
Voorham, J. (2002). Intra-population plasticity of Anopheles darlingi’s (Diptera,
Culicidae) biting activity patterns in the state of Amapá, Brazil. Rev Saúde Pública
2002;36(1):75-80.
Waide, R., Willig, M., Steiner, C., Mittelbach, G., Gough, L., Dodson, S., et al.
(1999). The relationship between productivity and species richness. Annu. Rev.
Ecol. Syst. 1999. 30:257–300.
Wang, S., Lengeler, C., Mtasiwa, D., Mshana, T., Manane, L., Maro, G., et al.
(2006). Rapid Urban Malaria Appraisal (RUMA) II: Epidemiology of urban malaria
in Dar es Salaam (Tanzania). Malar J. 2006 Apr 4;5:28.
Wang, S., Lengeler, C., Smith, T., Vounatsou, P., Cissé, G., Diallo, D., et al.
(2005). Rapid urban malaria appraisal (RUMA) in sub-Saharan Africa. Malar J
2005; 9;4:40 .
Wang, S., Lengeler, C., Smith, T., Vounatsou, P., Diadie, D. P., Convelbo, N., et
al. (2005). Rapid urban malaria appraisal (RUMA) I: epidemiology of urban
malaria in Ouagadougou. Malar J. 2005 Sep 16;4:43.
Warrell, D., & Gilles, H. (2002). Essential Malariology. 4th edition. New York.
Oxford University Press. 2002:192.
WHO. (1975). Manual on Practical Entomology in Malaria. Part II: Methods and
Techniques, Geneva, 191 pp.
WHO. (2012). World Malaria Report 2012. Geneva, Switzerland: WHO. pp288.
WHO. (2013). World Malaria Report 2013. Geneva, Switzerland: WHO. pp284.
Wielgosz, B., Mangheni, M., Tsegai, D., & Ringler, C. (2012). Malaria and
agriculture. IFPRI Discussion Paper 01232 .
86 Determinación del papel en la transmisión de malaria de las especies de Anopheles
Wirtz, R. (2009). Sporozoite ELISA directions. Center for Disease Control and
Prevention, Atlanta, USA.
Wirtz, R., Burkot, T., Andre, R., Rosenberg, R., Collins, W., & Roberts, D. (1985).
Identification of Plasmodium vivax sporozoites in mosquitoes using an enzyme-
linked immunosorbent assay. Am Jour Trop Med Hyg 1985; 34: 1048-1054p .
Wirtz, R., Burkot, T., Graves, P., & Andre, R. (1987). Field evaluation of enzyme-
linked immunosorbent assays for Plasmodium falciparum and Plasmodium vivax
sporozoites in mosquitoes (Diptera: Culicidae) from Papua New Guinea. J Med
Entomol. 1987;24:433-7. .
Yasuoka, J., & Levins, R. (2007). Impact of deforestation and agricultural
development on anopheline ecology and malaria epidemiology. Am J Trop Med
Hyg 2007; 76(3): 450-60 .
Ye-Ebiyo, Y., Pollack, R., & Spielman, A. (2000). Enhanced development in nature
of larval Anopheles arabiensis mosquitoes feeding on maize pollen. Am J Trop
Med Hyg 2000; 63(1-2):90-3 .
Zeilhofer, P., Santos, E., Ribeiro, A., Miyazaki, R., & Santos, M. (2007). Habitat
suitability mapping of Anopheles darlingi in the surroundings of the Manso
hydropower plant reservoir, Mato Grosso, Central Brazil. International Journal of
Health Geographics 2007; 6:7 .
Zimmerman, R. (1992). Ecology of malaria vectors in the Americas and future direction. Mem Inst Oswaldo Cruz 1992;87 (Suppl 3): 371-83 .